ID: 1202367281

View in Genome Browser
Species Human (GRCh38)
Location Y:24174085-24174107
Sequence CTAGAGCGGTACACAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367281_1202367286 2 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367286 Y:24174110-24174132 GCCCTGATCCCACAGGAGCTTGG No data
1202367281_1202367285 -5 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367285 Y:24174103-24174125 TCTAGGAGCCCTGATCCCACAGG No data
1202367281_1202367293 23 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367293 Y:24174131-24174153 GGGTGTGCGGACAAGCAGTGTGG No data
1202367281_1202367291 10 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367291 Y:24174118-24174140 CCCACAGGAGCTTGGGTGTGCGG No data
1202367281_1202367288 3 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367281 Original CRISPR CTAGAGCGGTACACAGGTAC TGG (reversed) Intergenic