ID: 1202367283

View in Genome Browser
Species Human (GRCh38)
Location Y:24174091-24174113
Sequence GGGCTCCTAGAGCGGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367283_1202367293 17 Left 1202367283 Y:24174091-24174113 CCTGTGTACCGCTCTAGGAGCCC No data
Right 1202367293 Y:24174131-24174153 GGGTGTGCGGACAAGCAGTGTGG No data
1202367283_1202367291 4 Left 1202367283 Y:24174091-24174113 CCTGTGTACCGCTCTAGGAGCCC No data
Right 1202367291 Y:24174118-24174140 CCCACAGGAGCTTGGGTGTGCGG No data
1202367283_1202367288 -3 Left 1202367283 Y:24174091-24174113 CCTGTGTACCGCTCTAGGAGCCC No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data
1202367283_1202367286 -4 Left 1202367283 Y:24174091-24174113 CCTGTGTACCGCTCTAGGAGCCC No data
Right 1202367286 Y:24174110-24174132 GCCCTGATCCCACAGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367283 Original CRISPR GGGCTCCTAGAGCGGTACAC AGG (reversed) Intergenic