ID: 1202367288

View in Genome Browser
Species Human (GRCh38)
Location Y:24174111-24174133
Sequence CCCTGATCCCACAGGAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367280_1202367288 26 Left 1202367280 Y:24174062-24174084 CCAAGTCTGCGGCAGCAGCAAGA No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data
1202367281_1202367288 3 Left 1202367281 Y:24174085-24174107 CCAGTACCTGTGTACCGCTCTAG No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data
1202367283_1202367288 -3 Left 1202367283 Y:24174091-24174113 CCTGTGTACCGCTCTAGGAGCCC No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367288 Original CRISPR CCCTGATCCCACAGGAGCTT GGG Intergenic