ID: 1202367822

View in Genome Browser
Species Human (GRCh38)
Location Y:24178977-24178999
Sequence GCTGTGCTTGCGGAGTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367822_1202367830 16 Left 1202367822 Y:24178977-24178999 CCACAAGACTCCGCAAGCACAGC No data
Right 1202367830 Y:24179016-24179038 AGTGCTAGAGCTGAGGCAGTTGG No data
1202367822_1202367827 9 Left 1202367822 Y:24178977-24178999 CCACAAGACTCCGCAAGCACAGC No data
Right 1202367827 Y:24179009-24179031 GATTCCCAGTGCTAGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367822 Original CRISPR GCTGTGCTTGCGGAGTCTTG TGG (reversed) Intergenic
No off target data available for this crispr