ID: 1202367937

View in Genome Browser
Species Human (GRCh38)
Location Y:24179609-24179631
Sequence GACGCCAGCGTGTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367937_1202367943 -7 Left 1202367937 Y:24179609-24179631 CCCACCCCACACACGCTGGCGTC No data
Right 1202367943 Y:24179625-24179647 TGGCGTCTCTCATGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367937 Original CRISPR GACGCCAGCGTGTGTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr