ID: 1202368980

View in Genome Browser
Species Human (GRCh38)
Location Y:24184791-24184813
Sequence GACCCCTCTGGAGGTACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202368975_1202368980 0 Left 1202368975 Y:24184768-24184790 CCATTTTCAAGGGCTGGCAGTGG No data
Right 1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202368980 Original CRISPR GACCCCTCTGGAGGTACTTG AGG Intergenic
No off target data available for this crispr