ID: 1202369494

View in Genome Browser
Species Human (GRCh38)
Location Y:24187343-24187365
Sequence CAGTGGTGATGTGGCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202369494_1202369500 -8 Left 1202369494 Y:24187343-24187365 CCTCCCAGGCCACATCACCACTG No data
Right 1202369500 Y:24187358-24187380 CACCACTGCTCTGGTCCTGGTGG No data
1202369494_1202369504 28 Left 1202369494 Y:24187343-24187365 CCTCCCAGGCCACATCACCACTG No data
Right 1202369504 Y:24187394-24187416 CATATCATCTTCCGTGATCTTGG No data
1202369494_1202369502 5 Left 1202369494 Y:24187343-24187365 CCTCCCAGGCCACATCACCACTG No data
Right 1202369502 Y:24187371-24187393 GTCCTGGTGGCAGCAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202369494 Original CRISPR CAGTGGTGATGTGGCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr