ID: 1202374163

View in Genome Browser
Species Human (GRCh38)
Location Y:24218190-24218212
Sequence TTGCCCTTGCCAATCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202374163_1202374168 1 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374168 Y:24218214-24218236 GACTGAGTGGCTTGCTGAAGGGG No data
1202374163_1202374175 30 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374175 Y:24218243-24218265 TGACTGAGAAGACTTTGGTGGGG No data
1202374163_1202374173 28 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374173 Y:24218241-24218263 GCTGACTGAGAAGACTTTGGTGG No data
1202374163_1202374174 29 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374174 Y:24218242-24218264 CTGACTGAGAAGACTTTGGTGGG No data
1202374163_1202374172 25 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374172 Y:24218238-24218260 GGGGCTGACTGAGAAGACTTTGG No data
1202374163_1202374169 4 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374169 Y:24218217-24218239 TGAGTGGCTTGCTGAAGGGGTGG No data
1202374163_1202374166 -1 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374166 Y:24218212-24218234 AGGACTGAGTGGCTTGCTGAAGG No data
1202374163_1202374167 0 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374167 Y:24218213-24218235 GGACTGAGTGGCTTGCTGAAGGG No data
1202374163_1202374171 6 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374171 Y:24218219-24218241 AGTGGCTTGCTGAAGGGGTGGGG No data
1202374163_1202374170 5 Left 1202374163 Y:24218190-24218212 CCTGTGGTGATTGGCAAGGGCAA No data
Right 1202374170 Y:24218218-24218240 GAGTGGCTTGCTGAAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202374163 Original CRISPR TTGCCCTTGCCAATCACCAC AGG (reversed) Intergenic
No off target data available for this crispr