ID: 1202376214

View in Genome Browser
Species Human (GRCh38)
Location Y:24240024-24240046
Sequence CTGGTTTTCCGTGGTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202376214_1202376224 30 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376224 Y:24240077-24240099 TGCCTGCAATCTGGGCACTTTGG No data
1202376214_1202376217 -5 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376217 Y:24240042-24240064 ACCAGAAAAACAAGTTGGCCAGG No data
1202376214_1202376216 -10 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376216 Y:24240037-24240059 GGAAAACCAGAAAAACAAGTTGG No data
1202376214_1202376222 21 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376222 Y:24240068-24240090 GGTGGCTCATGCCTGCAATCTGG No data
1202376214_1202376219 0 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376219 Y:24240047-24240069 AAAAACAAGTTGGCCAGGTGTGG No data
1202376214_1202376220 3 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376220 Y:24240050-24240072 AACAAGTTGGCCAGGTGTGGTGG No data
1202376214_1202376223 22 Left 1202376214 Y:24240024-24240046 CCATGAAAACCACGGAAAACCAG No data
Right 1202376223 Y:24240069-24240091 GTGGCTCATGCCTGCAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202376214 Original CRISPR CTGGTTTTCCGTGGTTTTCA TGG (reversed) Intergenic
No off target data available for this crispr