ID: 1202377507

View in Genome Browser
Species Human (GRCh38)
Location Y:24250589-24250611
Sequence TCAGACCCAGGCGTGACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202377507_1202377511 3 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377511 Y:24250615-24250637 TCCCCTGTAGGACTCCATATGGG No data
1202377507_1202377521 30 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377521 Y:24250642-24250664 GATGGCAGGATATGATAACAGGG No data
1202377507_1202377510 2 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377510 Y:24250614-24250636 GTCCCCTGTAGGACTCCATATGG No data
1202377507_1202377517 16 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377517 Y:24250628-24250650 TCCATATGGGGCCAGATGGCAGG No data
1202377507_1202377520 29 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377507_1202377509 -9 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377509 Y:24250603-24250625 TGGGTCTGAGAGTCCCCTGTAGG No data
1202377507_1202377513 4 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377513 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
1202377507_1202377516 12 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377516 Y:24250624-24250646 GGACTCCATATGGGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202377507 Original CRISPR TCAGACCCAGGCGTGACCAC TGG (reversed) Intergenic