ID: 1202377508

View in Genome Browser
Species Human (GRCh38)
Location Y:24250601-24250623
Sequence TACAGGGGACTCTCAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202377508_1202377521 18 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377521 Y:24250642-24250664 GATGGCAGGATATGATAACAGGG No data
1202377508_1202377513 -8 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377513 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
1202377508_1202377516 0 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377516 Y:24250624-24250646 GGACTCCATATGGGGCCAGATGG No data
1202377508_1202377517 4 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377517 Y:24250628-24250650 TCCATATGGGGCCAGATGGCAGG No data
1202377508_1202377522 29 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377508_1202377511 -9 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377511 Y:24250615-24250637 TCCCCTGTAGGACTCCATATGGG No data
1202377508_1202377520 17 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377508_1202377510 -10 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377510 Y:24250614-24250636 GTCCCCTGTAGGACTCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202377508 Original CRISPR TACAGGGGACTCTCAGACCC AGG (reversed) Intergenic