ID: 1202377512

View in Genome Browser
Species Human (GRCh38)
Location Y:24250616-24250638
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202377512_1202377521 3 Left 1202377512 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
Right 1202377521 Y:24250642-24250664 GATGGCAGGATATGATAACAGGG No data
1202377512_1202377522 14 Left 1202377512 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377512_1202377520 2 Left 1202377512 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202377512 Original CRISPR CCCCATATGGAGTCCTACAG GGG (reversed) Intergenic