ID: 1202377515 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:24250618-24250640 |
| Sequence | GGCCCCATATGGAGTCCTAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202377515_1202377520 | 0 | Left | 1202377515 | Y:24250618-24250640 | CCTGTAGGACTCCATATGGGGCC | No data | ||
| Right | 1202377520 | Y:24250641-24250663 | AGATGGCAGGATATGATAACAGG | No data | ||||
| 1202377515_1202377522 | 12 | Left | 1202377515 | Y:24250618-24250640 | CCTGTAGGACTCCATATGGGGCC | No data | ||
| Right | 1202377522 | Y:24250653-24250675 | ATGATAACAGGGTGTAAGTCAGG | No data | ||||
| 1202377515_1202377521 | 1 | Left | 1202377515 | Y:24250618-24250640 | CCTGTAGGACTCCATATGGGGCC | No data | ||
| Right | 1202377521 | Y:24250642-24250664 | GATGGCAGGATATGATAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202377515 | Original CRISPR | GGCCCCATATGGAGTCCTAC AGG (reversed) | Intergenic | ||