ID: 1202377520

View in Genome Browser
Species Human (GRCh38)
Location Y:24250641-24250663
Sequence AGATGGCAGGATATGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202377514_1202377520 1 Left 1202377514 Y:24250617-24250639 CCCTGTAGGACTCCATATGGGGC No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377515_1202377520 0 Left 1202377515 Y:24250618-24250640 CCTGTAGGACTCCATATGGGGCC No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377507_1202377520 29 Left 1202377507 Y:24250589-24250611 CCAGTGGTCACGCCTGGGTCTGA No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377508_1202377520 17 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data
1202377512_1202377520 2 Left 1202377512 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
Right 1202377520 Y:24250641-24250663 AGATGGCAGGATATGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202377520 Original CRISPR AGATGGCAGGATATGATAAC AGG Intergenic