ID: 1202377522

View in Genome Browser
Species Human (GRCh38)
Location Y:24250653-24250675
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202377508_1202377522 29 Left 1202377508 Y:24250601-24250623 CCTGGGTCTGAGAGTCCCCTGTA No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377519_1202377522 -9 Left 1202377519 Y:24250639-24250661 CCAGATGGCAGGATATGATAACA No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377512_1202377522 14 Left 1202377512 Y:24250616-24250638 CCCCTGTAGGACTCCATATGGGG No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377515_1202377522 12 Left 1202377515 Y:24250618-24250640 CCTGTAGGACTCCATATGGGGCC No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377514_1202377522 13 Left 1202377514 Y:24250617-24250639 CCCTGTAGGACTCCATATGGGGC No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data
1202377518_1202377522 1 Left 1202377518 Y:24250629-24250651 CCATATGGGGCCAGATGGCAGGA No data
Right 1202377522 Y:24250653-24250675 ATGATAACAGGGTGTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202377522 Original CRISPR ATGATAACAGGGTGTAAGTC AGG Intergenic