ID: 1202379027

View in Genome Browser
Species Human (GRCh38)
Location Y:24260529-24260551
Sequence TCCCTTCCAGGGCCCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379027_1202379031 -1 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data
1202379027_1202379040 14 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379040 Y:24260566-24260588 TCTGCAGGCCCACATGACTCAGG 0: 3
1: 0
2: 1
3: 22
4: 188
1202379027_1202379042 16 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379042 Y:24260568-24260590 TGCAGGCCCACATGACTCAGGGG No data
1202379027_1202379041 15 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379027_1202379045 25 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379027 Original CRISPR TCCCTTCCAGGGCCCTGAGT GGG (reversed) Intergenic