ID: 1202379029

View in Genome Browser
Species Human (GRCh38)
Location Y:24260540-24260562
Sequence GGGTGGGGGTCTCCCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379029_1202379041 4 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379029_1202379048 29 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG No data
1202379029_1202379040 3 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379040 Y:24260566-24260588 TCTGCAGGCCCACATGACTCAGG 0: 3
1: 0
2: 1
3: 22
4: 188
1202379029_1202379047 23 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379047 Y:24260586-24260608 AGGGGAGTAGAAGGAAGAAAGGG No data
1202379029_1202379045 14 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379029_1202379042 5 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379042 Y:24260568-24260590 TGCAGGCCCACATGACTCAGGGG No data
1202379029_1202379046 22 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379029 Original CRISPR GGGTGGGGGTCTCCCTTCCA GGG (reversed) Intergenic