ID: 1202379031

View in Genome Browser
Species Human (GRCh38)
Location Y:24260551-24260573
Sequence AGACCCCCACCCCCATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379020_1202379031 17 Left 1202379020 Y:24260511-24260533 CCTCTTTCACCTGGTCTGCCCAC No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data
1202379027_1202379031 -1 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data
1202379018_1202379031 30 Left 1202379018 Y:24260498-24260520 CCACAGCAACTTTCCTCTTTCAC No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data
1202379028_1202379031 -2 Left 1202379028 Y:24260530-24260552 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data
1202379023_1202379031 8 Left 1202379023 Y:24260520-24260542 CCTGGTCTGCCCACTCAGGGCCC No data
Right 1202379031 Y:24260551-24260573 AGACCCCCACCCCCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379031 Original CRISPR AGACCCCCACCCCCATCTGC AGG Intergenic