ID: 1202379032

View in Genome Browser
Species Human (GRCh38)
Location Y:24260554-24260576
Sequence GGGCCTGCAGATGGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379032_1202379045 0 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379032_1202379046 8 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG No data
1202379032_1202379049 30 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379032_1202379042 -9 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379042 Y:24260568-24260590 TGCAGGCCCACATGACTCAGGGG No data
1202379032_1202379047 9 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379047 Y:24260586-24260608 AGGGGAGTAGAAGGAAGAAAGGG No data
1202379032_1202379048 15 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG No data
1202379032_1202379041 -10 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379032 Original CRISPR GGGCCTGCAGATGGGGGTGG GGG (reversed) Intergenic