ID: 1202379036

View in Genome Browser
Species Human (GRCh38)
Location Y:24260560-24260582
Sequence TCATGTGGGCCTGCAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379036_1202379049 24 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379036_1202379048 9 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG No data
1202379036_1202379046 2 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG No data
1202379036_1202379047 3 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379047 Y:24260586-24260608 AGGGGAGTAGAAGGAAGAAAGGG No data
1202379036_1202379045 -6 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379036 Original CRISPR TCATGTGGGCCTGCAGATGG GGG (reversed) Intergenic