ID: 1202379038

View in Genome Browser
Species Human (GRCh38)
Location Y:24260562-24260584
Sequence AGTCATGTGGGCCTGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379038_1202379049 22 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379038_1202379045 -8 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379038_1202379048 7 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG No data
1202379038_1202379047 1 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379047 Y:24260586-24260608 AGGGGAGTAGAAGGAAGAAAGGG No data
1202379038_1202379046 0 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379038 Original CRISPR AGTCATGTGGGCCTGCAGAT GGG (reversed) Intergenic