ID: 1202379039

View in Genome Browser
Species Human (GRCh38)
Location Y:24260563-24260585
Sequence GAGTCATGTGGGCCTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379039_1202379045 -9 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379039_1202379047 0 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379047 Y:24260586-24260608 AGGGGAGTAGAAGGAAGAAAGGG No data
1202379039_1202379052 30 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379052 Y:24260616-24260638 CAGCCTCCCTGCGGAGCCTAAGG No data
1202379039_1202379046 -1 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG No data
1202379039_1202379048 6 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG No data
1202379039_1202379049 21 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379039 Original CRISPR GAGTCATGTGGGCCTGCAGA TGG (reversed) Intergenic