ID: 1202379041

View in Genome Browser
Species Human (GRCh38)
Location Y:24260567-24260589
Sequence CTGCAGGCCCACATGACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379028_1202379041 14 Left 1202379028 Y:24260530-24260552 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379029_1202379041 4 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379027_1202379041 15 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379032_1202379041 -10 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379023_1202379041 24 Left 1202379023 Y:24260520-24260542 CCTGGTCTGCCCACTCAGGGCCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data
1202379030_1202379041 3 Left 1202379030 Y:24260541-24260563 CCTGGAAGGGAGACCCCCACCCC No data
Right 1202379041 Y:24260567-24260589 CTGCAGGCCCACATGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379041 Original CRISPR CTGCAGGCCCACATGACTCA GGG Intergenic