ID: 1202379045

View in Genome Browser
Species Human (GRCh38)
Location Y:24260577-24260599
Sequence ACATGACTCAGGGGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379036_1202379045 -6 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379029_1202379045 14 Left 1202379029 Y:24260540-24260562 CCCTGGAAGGGAGACCCCCACCC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379028_1202379045 24 Left 1202379028 Y:24260530-24260552 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379027_1202379045 25 Left 1202379027 Y:24260529-24260551 CCCACTCAGGGCCCTGGAAGGGA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379032_1202379045 0 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379038_1202379045 -8 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379034_1202379045 -2 Left 1202379034 Y:24260556-24260578 CCCACCCCCATCTGCAGGCCCAC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379030_1202379045 13 Left 1202379030 Y:24260541-24260563 CCTGGAAGGGAGACCCCCACCCC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379033_1202379045 -1 Left 1202379033 Y:24260555-24260577 CCCCACCCCCATCTGCAGGCCCA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379039_1202379045 -9 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379037_1202379045 -7 Left 1202379037 Y:24260561-24260583 CCCCATCTGCAGGCCCACATGAC No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data
1202379035_1202379045 -3 Left 1202379035 Y:24260557-24260579 CCACCCCCATCTGCAGGCCCACA No data
Right 1202379045 Y:24260577-24260599 ACATGACTCAGGGGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379045 Original CRISPR ACATGACTCAGGGGAGTAGA AGG Intergenic