ID: 1202379049

View in Genome Browser
Species Human (GRCh38)
Location Y:24260607-24260629
Sequence GGACCAGGCCAGCCTCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202379039_1202379049 21 Left 1202379039 Y:24260563-24260585 CCATCTGCAGGCCCACATGACTC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379036_1202379049 24 Left 1202379036 Y:24260560-24260582 CCCCCATCTGCAGGCCCACATGA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379032_1202379049 30 Left 1202379032 Y:24260554-24260576 CCCCCACCCCCATCTGCAGGCCC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379034_1202379049 28 Left 1202379034 Y:24260556-24260578 CCCACCCCCATCTGCAGGCCCAC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379037_1202379049 23 Left 1202379037 Y:24260561-24260583 CCCCATCTGCAGGCCCACATGAC No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379044_1202379049 9 Left 1202379044 Y:24260575-24260597 CCACATGACTCAGGGGAGTAGAA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379038_1202379049 22 Left 1202379038 Y:24260562-24260584 CCCATCTGCAGGCCCACATGACT No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379033_1202379049 29 Left 1202379033 Y:24260555-24260577 CCCCACCCCCATCTGCAGGCCCA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379043_1202379049 10 Left 1202379043 Y:24260574-24260596 CCCACATGACTCAGGGGAGTAGA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data
1202379035_1202379049 27 Left 1202379035 Y:24260557-24260579 CCACCCCCATCTGCAGGCCCACA No data
Right 1202379049 Y:24260607-24260629 GGACCAGGCCAGCCTCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202379049 Original CRISPR GGACCAGGCCAGCCTCCCTG CGG Intergenic