ID: 1202381427

View in Genome Browser
Species Human (GRCh38)
Location Y:24278671-24278693
Sequence ACTGCAGGTGAAACAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202381427_1202381433 26 Left 1202381427 Y:24278671-24278693 CCAGCATCTGTTTCACCTGCAGT No data
Right 1202381433 Y:24278720-24278742 TCATGCAGTCATCAGTCCCATGG No data
1202381427_1202381429 -8 Left 1202381427 Y:24278671-24278693 CCAGCATCTGTTTCACCTGCAGT No data
Right 1202381429 Y:24278686-24278708 CCTGCAGTTGAAGATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202381427 Original CRISPR ACTGCAGGTGAAACAGATGC TGG (reversed) Intergenic
No off target data available for this crispr