ID: 1202385888

View in Genome Browser
Species Human (GRCh38)
Location Y:24326039-24326061
Sequence ATGGCTCCACACTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202385888_1202385895 14 Left 1202385888 Y:24326039-24326061 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1202385895 Y:24326076-24326098 GGGGACCCAGCAGTCAGCTGTGG No data
1202385888_1202385890 -7 Left 1202385888 Y:24326039-24326061 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1202385890 Y:24326055-24326077 GAGCCATGCACTAGGTCTGCCGG No data
1202385888_1202385891 -6 Left 1202385888 Y:24326039-24326061 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1202385891 Y:24326056-24326078 AGCCATGCACTAGGTCTGCCGGG No data
1202385888_1202385892 -5 Left 1202385888 Y:24326039-24326061 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1202385892 Y:24326057-24326079 GCCATGCACTAGGTCTGCCGGGG No data
1202385888_1202385896 15 Left 1202385888 Y:24326039-24326061 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1202385896 Y:24326077-24326099 GGGACCCAGCAGTCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202385888 Original CRISPR ATGGCTCCACACTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr