ID: 1202398859

View in Genome Browser
Species Human (GRCh38)
Location Y:24453188-24453210
Sequence TCACCAAGCCTGCTATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202398859_1202398861 -8 Left 1202398859 Y:24453188-24453210 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202398861 Y:24453203-24453225 CTTGGTGACATACTATTTCAGGG No data
1202398859_1202398864 23 Left 1202398859 Y:24453188-24453210 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202398864 Y:24453234-24453256 GGTTGTGTGATTTTCCAAATAGG No data
1202398859_1202398862 2 Left 1202398859 Y:24453188-24453210 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202398862 Y:24453213-24453235 TACTATTTCAGGGTGTATCCAGG No data
1202398859_1202398860 -9 Left 1202398859 Y:24453188-24453210 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202398860 Y:24453202-24453224 GCTTGGTGACATACTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202398859 Original CRISPR TCACCAAGCCTGCTATAGAC AGG (reversed) Intergenic
No off target data available for this crispr