ID: 1202400608

View in Genome Browser
Species Human (GRCh38)
Location Y:24469667-24469689
Sequence TCCAGGGCCATTCCTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202400605_1202400608 5 Left 1202400605 Y:24469639-24469661 CCAGGCACATCACTGATGATACT No data
Right 1202400608 Y:24469667-24469689 TCCAGGGCCATTCCTCAAAGAGG No data
1202400604_1202400608 11 Left 1202400604 Y:24469633-24469655 CCTAGGCCAGGCACATCACTGAT No data
Right 1202400608 Y:24469667-24469689 TCCAGGGCCATTCCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202400608 Original CRISPR TCCAGGGCCATTCCTCAAAG AGG Intergenic
No off target data available for this crispr