ID: 1202404514

View in Genome Browser
Species Human (GRCh38)
Location Y:24512076-24512098
Sequence GGAGGCCACACGGAGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202404514_1202404521 -1 Left 1202404514 Y:24512076-24512098 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202404521 Y:24512098-24512120 CATGTACACAGGGCCCAAGGAGG No data
1202404514_1202404525 23 Left 1202404514 Y:24512076-24512098 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202404525 Y:24512122-24512144 AGTCACTTCACCTAGATGATAGG No data
1202404514_1202404522 0 Left 1202404514 Y:24512076-24512098 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202404522 Y:24512099-24512121 ATGTACACAGGGCCCAAGGAGGG No data
1202404514_1202404519 -4 Left 1202404514 Y:24512076-24512098 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202404514 Original CRISPR GGAGGCCACACGGAGCATTG TGG (reversed) Intergenic
No off target data available for this crispr