ID: 1202404519

View in Genome Browser
Species Human (GRCh38)
Location Y:24512095-24512117
Sequence CTCCATGTACACAGGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202404514_1202404519 -4 Left 1202404514 Y:24512076-24512098 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202404519 Original CRISPR CTCCATGTACACAGGGCCCA AGG Intergenic
No off target data available for this crispr