ID: 1202405202 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:24518764-24518786 |
Sequence | GAGTCACTTCACCTGGCTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202405197_1202405202 | 23 | Left | 1202405197 | Y:24518718-24518740 | CCAGTGAGATGTCACAATCTTTC | No data | ||
Right | 1202405202 | Y:24518764-24518786 | GAGTCACTTCACCTGGCTACTGG | No data | ||||
1202405200_1202405202 | -6 | Left | 1202405200 | Y:24518747-24518769 | CCAGGACTCTGGAAGAAGAGTCA | No data | ||
Right | 1202405202 | Y:24518764-24518786 | GAGTCACTTCACCTGGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202405202 | Original CRISPR | GAGTCACTTCACCTGGCTAC TGG | Intergenic | ||
No off target data available for this crispr |