ID: 1202405202

View in Genome Browser
Species Human (GRCh38)
Location Y:24518764-24518786
Sequence GAGTCACTTCACCTGGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202405197_1202405202 23 Left 1202405197 Y:24518718-24518740 CCAGTGAGATGTCACAATCTTTC No data
Right 1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG No data
1202405200_1202405202 -6 Left 1202405200 Y:24518747-24518769 CCAGGACTCTGGAAGAAGAGTCA No data
Right 1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202405202 Original CRISPR GAGTCACTTCACCTGGCTAC TGG Intergenic
No off target data available for this crispr