ID: 1202406050

View in Genome Browser
Species Human (GRCh38)
Location Y:24526697-24526719
Sequence CTGTGTGAGTCCAAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202406048_1202406050 6 Left 1202406048 Y:24526668-24526690 CCATGGCTCTGAGAGTCAAAATA No data
Right 1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG No data
1202406046_1202406050 18 Left 1202406046 Y:24526656-24526678 CCAGGACTTTACCCATGGCTCTG No data
Right 1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG No data
1202406047_1202406050 7 Left 1202406047 Y:24526667-24526689 CCCATGGCTCTGAGAGTCAAAAT No data
Right 1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202406050 Original CRISPR CTGTGTGAGTCCAAGTATGA GGG Intergenic
No off target data available for this crispr