ID: 1202407752

View in Genome Browser
Species Human (GRCh38)
Location Y:24543171-24543193
Sequence CCTTCTATTCAGAGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202407746_1202407752 25 Left 1202407746 Y:24543123-24543145 CCTTCTTGTCAAGTTTTTTCCTA No data
Right 1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG No data
1202407748_1202407752 6 Left 1202407748 Y:24543142-24543164 CCTACAAATTGGATTATTAAATT No data
Right 1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202407752 Original CRISPR CCTTCTATTCAGAGGGATGA TGG Intergenic
No off target data available for this crispr