ID: 1202411836

View in Genome Browser
Species Human (GRCh38)
Location Y:24582219-24582241
Sequence AAGCCAGATGGTCCTTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202411830_1202411836 -4 Left 1202411830 Y:24582200-24582222 CCTCCATTAACTAACCTTTAAGC No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411824_1202411836 20 Left 1202411824 Y:24582176-24582198 CCCCAATTAAGTTTTTTTACCCC No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411825_1202411836 19 Left 1202411825 Y:24582177-24582199 CCCAATTAAGTTTTTTTACCCCA No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411827_1202411836 1 Left 1202411827 Y:24582195-24582217 CCCCACCTCCATTAACTAACCTT 0: 4
1: 27
2: 17
3: 19
4: 161
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411829_1202411836 -1 Left 1202411829 Y:24582197-24582219 CCACCTCCATTAACTAACCTTTA No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411828_1202411836 0 Left 1202411828 Y:24582196-24582218 CCCACCTCCATTAACTAACCTTT 0: 36
1: 18
2: 10
3: 16
4: 190
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411826_1202411836 18 Left 1202411826 Y:24582178-24582200 CCAATTAAGTTTTTTTACCCCAC No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data
1202411831_1202411836 -7 Left 1202411831 Y:24582203-24582225 CCATTAACTAACCTTTAAGCCAG No data
Right 1202411836 Y:24582219-24582241 AAGCCAGATGGTCCTTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202411836 Original CRISPR AAGCCAGATGGTCCTTTCTG GGG Intergenic
No off target data available for this crispr