ID: 1202413703

View in Genome Browser
Species Human (GRCh38)
Location Y:24601173-24601195
Sequence TATAATCCCCAGTGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202413703_1202413706 22 Left 1202413703 Y:24601173-24601195 CCCTGCTTCCACTGGGGATTATA No data
Right 1202413706 Y:24601218-24601240 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202413703 Original CRISPR TATAATCCCCAGTGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr