ID: 1202414125

View in Genome Browser
Species Human (GRCh38)
Location Y:24605418-24605440
Sequence CACCTTTAGCAACGTGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202414121_1202414125 26 Left 1202414121 Y:24605369-24605391 CCCAGAGCAGAGTTGAAATTGTG No data
Right 1202414125 Y:24605418-24605440 CACCTTTAGCAACGTGACAGGGG No data
1202414122_1202414125 25 Left 1202414122 Y:24605370-24605392 CCAGAGCAGAGTTGAAATTGTGA No data
Right 1202414125 Y:24605418-24605440 CACCTTTAGCAACGTGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202414125 Original CRISPR CACCTTTAGCAACGTGACAG GGG Intergenic
No off target data available for this crispr