ID: 1202415840

View in Genome Browser
Species Human (GRCh38)
Location Y:24621484-24621506
Sequence TTTCCTGGCAATAGTGTGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202415837_1202415840 20 Left 1202415837 Y:24621441-24621463 CCAGCACTGAGGTAGAGTAGAGT 0: 3
1: 0
2: 0
3: 3
4: 110
Right 1202415840 Y:24621484-24621506 TTTCCTGGCAATAGTGTGCTTGG 0: 3
1: 0
2: 0
3: 17
4: 201
1202415836_1202415840 21 Left 1202415836 Y:24621440-24621462 CCCAGCACTGAGGTAGAGTAGAG 0: 3
1: 0
2: 0
3: 8
4: 123
Right 1202415840 Y:24621484-24621506 TTTCCTGGCAATAGTGTGCTTGG 0: 3
1: 0
2: 0
3: 17
4: 201
1202415839_1202415840 -9 Left 1202415839 Y:24621470-24621492 CCTCTTTTTCTTTTTTTCCTGGC 0: 3
1: 1
2: 18
3: 209
4: 2101
Right 1202415840 Y:24621484-24621506 TTTCCTGGCAATAGTGTGCTTGG 0: 3
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202415840 Original CRISPR TTTCCTGGCAATAGTGTGCT TGG Exonic
903739934 1:25552843-25552865 TTTCCTGACATTTGTGTGGTTGG + Intronic
906075101 1:43046362-43046384 ATTCCTGGCAATCGCGTCCTTGG - Intergenic
909906844 1:81207247-81207269 ATTCCTGTCAATAGTGTGAAAGG - Intergenic
913157429 1:116113786-116113808 TTGCCTGGAAACTGTGTGCTGGG + Intronic
915733076 1:158067717-158067739 CTTCCTGGCAGGACTGTGCTGGG + Intronic
916028152 1:160853207-160853229 TTTCCTGGCAATAATGTGGATGG + Intronic
918241429 1:182623589-182623611 TTTCCTGCCCATTGTATGCTGGG + Intergenic
920114711 1:203612102-203612124 TGTCCTTGCGATAGTTTGCTAGG + Intergenic
920631105 1:207652907-207652929 TTTCTTGGCAATAGATTGCCTGG + Intronic
920641631 1:207757369-207757391 TTTCCTGGCAATAGATTGCCTGG + Intronic
922755759 1:228096114-228096136 TTTCCTTGCCGTAGCGTGCTGGG + Intronic
1065050250 10:21784780-21784802 TGTCCTTGCGATAGTTTGCTCGG - Intronic
1066034191 10:31464758-31464780 TTTGCTGGGTATAGTATGCTTGG - Intronic
1066702392 10:38143858-38143880 TTTCCTGGCAATAGTAAGTGAGG + Intergenic
1069045685 10:63741023-63741045 TGTCATGGCAATAGTGAGTTCGG - Intergenic
1071084021 10:81847168-81847190 TGTCCTTGCGATAGTTTGCTCGG + Intergenic
1072911978 10:99510345-99510367 ATTCCTGCCAATAGTGTACAAGG - Intergenic
1073894605 10:108140476-108140498 GTTCCAGGCAATATTGTTCTTGG - Intergenic
1074710852 10:116176434-116176456 TGTCCTTGCAATGGTGTTCTCGG + Intronic
1075708511 10:124517779-124517801 TTTGCTGGCAAAAGTCTGCCTGG + Intronic
1075928707 10:126274606-126274628 TTTCCTGGCAATGCAGAGCTAGG - Intronic
1076571010 10:131432784-131432806 TTTCCTGGCTCTGCTGTGCTGGG - Intergenic
1078024464 11:7681487-7681509 TTTGCTAGAAATAGTGTGGTTGG + Intergenic
1079806846 11:24942353-24942375 TTTCCTGGCAATACTTGGTTTGG + Intronic
1087357313 11:97111004-97111026 TTTCCTAGCGATAGTGAACTAGG - Intergenic
1087732964 11:101799179-101799201 ATTCCTGCCAACAGTGTGCAAGG - Intronic
1088494047 11:110415997-110416019 TTCCCTTGAAATAGTGTGTTTGG - Intergenic
1089184059 11:116602967-116602989 TTTCCTGGAAATAGGGAGTTGGG - Intergenic
1090121467 11:124033243-124033265 TGTCCTTGCGATAGTTTGCTGGG - Intergenic
1090135254 11:124191145-124191167 CTCCCTGGAAATAGTGTGCTTGG - Intergenic
1090911788 11:131127523-131127545 TTTGCTGGGTATAGTGTCCTTGG + Intergenic
1092214464 12:6671359-6671381 TTTCCTGTCATTAGGGGGCTGGG - Intronic
1092671191 12:10862633-10862655 TTTGCTGGAAATAGTATTCTTGG - Intronic
1093126234 12:15331441-15331463 TTTACTGGCAGTAGGATGCTGGG + Intronic
1093229152 12:16521883-16521905 TCTCTTGACAATAGTGTTCTCGG - Intronic
1095132562 12:38561295-38561317 TTTCCTGGCAATGTTGGTCTTGG - Intergenic
1096045322 12:48557123-48557145 TTTCTTGGAAACAGTGTGGTAGG - Intergenic
1097362948 12:58678439-58678461 TTTGCTGGATATAGTGTTCTTGG + Intronic
1097479975 12:60111540-60111562 TTTGCTAGCAATACTCTGCTAGG + Intergenic
1101421022 12:104551201-104551223 TTTCCTGTCGAAAGTCTGCTGGG - Intronic
1103317187 12:120065489-120065511 TTTCCTGTCAAGTGTGAGCTTGG - Intronic
1105388205 13:19951769-19951791 ATTCCTAGCAACAGTGTGCAAGG - Intergenic
1106723287 13:32457608-32457630 TTTCCTGGGTATAGTATTCTTGG - Intronic
1107065190 13:36206458-36206480 TTTCAAGGCAATAGTATGTTTGG + Intronic
1107430454 13:40335698-40335720 TGTCCTTGCGATAGTTTGCTGGG - Intergenic
1108544640 13:51480521-51480543 TTTAATGGCAATCGTGTGCCAGG - Intergenic
1111058996 13:82987763-82987785 TTTCATGGCAATGGTTTGCCTGG + Intergenic
1112991750 13:105522122-105522144 TTTACAGGCAATAGTGTTGTAGG + Intergenic
1113370334 13:109718723-109718745 TTTCCTTGCAAAAGAGTACTTGG + Intergenic
1120828060 14:88973156-88973178 TGTCCTTGCGATAGTTTGCTCGG - Intergenic
1121674191 14:95739270-95739292 TTTCCTGGAAACAGTGTGGTTGG + Intergenic
1121768106 14:96504855-96504877 TTTCCCGGCTATATTGTGTTTGG + Intronic
1123187790 14:106537064-106537086 TTTCCAGGCAATAGTGAGTGAGG + Intergenic
1124508716 15:30304023-30304045 TCTCCTGGCAAGACTGTGCTTGG + Intergenic
1124734842 15:32234639-32234661 TCTCCTGGCAAGACTGTGCTTGG - Intergenic
1125327602 15:38552817-38552839 TCTCCTAGCAGTGGTGTGCTGGG - Intronic
1125606989 15:40945126-40945148 TGTTCTGCTAATAGTGTGCTTGG + Intergenic
1126306918 15:47270338-47270360 ATTACTAGCAATAGTGTACTTGG - Intronic
1126408246 15:48344937-48344959 ACTCCTGGCAATATTCTGCTTGG - Intergenic
1128676989 15:69617292-69617314 TGTCCTTGCGATAGTTTGCTTGG + Intergenic
1129870216 15:78935092-78935114 TTTCCTGAAAATAATGTGTTTGG - Intronic
1129975400 15:79817166-79817188 TTTCCTGAGAATCATGTGCTGGG - Intergenic
1131339121 15:91579767-91579789 TGTCCTTGCGATAGTTTGCTGGG + Intergenic
1140347720 16:74230378-74230400 TAACCTGGCAATAATGTGCTTGG + Intergenic
1141473918 16:84259052-84259074 TTTCTTGGGAATAGGGTGGTAGG + Intergenic
1144107443 17:11998271-11998293 TTTCCAGGCCATCCTGTGCTGGG + Intergenic
1144645121 17:16967796-16967818 TTTCCTTAAAATAGTGTGTTTGG - Intronic
1146063534 17:29619076-29619098 ATTCCTGGCAGTAGGGTGCCAGG + Exonic
1147459691 17:40560340-40560362 TTTCCTGGCGCTATTGAGCTTGG - Intronic
1149139463 17:53412918-53412940 TGTCCTTGCAATAGTTTGGTCGG - Intergenic
1151352662 17:73541002-73541024 TTTCCTGGCAAATGTGGTCTCGG + Intronic
1156025853 18:32654525-32654547 TGTCCTTGCGATAGTTTGCTGGG - Intergenic
1157744742 18:50125252-50125274 TTTCCTTGCGACAGTTTGCTCGG - Intronic
1159283628 18:66320500-66320522 TTACCTGGCACTTGTGAGCTTGG - Intergenic
1160131917 18:76232923-76232945 GTTCCTGGCAATGGTGTCTTTGG - Intergenic
1161463853 19:4416210-4416232 TTTCCTGGCAATGGTCTGAGGGG - Intronic
1164550071 19:29203082-29203104 GTTCCTGGCAGTACTGTGTTTGG + Intergenic
1167749313 19:51370388-51370410 TTGCCTGGCAAGAGAGTGCAGGG - Intergenic
925301866 2:2822237-2822259 ATTCCTACCAATAGTGTGCAAGG - Intergenic
927080742 2:19627536-19627558 TTTCCTGGGAATAGTATTCTTGG - Intergenic
927643258 2:24859372-24859394 TATCCTGGCAACAGTGAGGTCGG - Intronic
927656129 2:24948234-24948256 TTTCATGACAAGTGTGTGCTGGG + Intronic
930200158 2:48545149-48545171 TTTCCTGGGAATTGTCTGATAGG + Intronic
930545339 2:52760553-52760575 TGTCCTTGCAATAGTTTGCTGGG - Intergenic
931482842 2:62659632-62659654 TTTGCTGGTCAAAGTGTGCTTGG + Intergenic
933002066 2:76937379-76937401 TTTCCTGACAATGATGTGATGGG + Intronic
934899600 2:98147970-98147992 AGTCCTTGCAATAGTTTGCTGGG + Intronic
934986266 2:98887876-98887898 TTTGCTGGATATAGTGTTCTTGG - Intronic
937608574 2:123832338-123832360 TTTCCTGGATATAGAGTTCTTGG + Intergenic
938226570 2:129621631-129621653 TTTCCCAGCAACAGTGTGCCAGG - Intergenic
938962608 2:136356759-136356781 TTTCCTGGAAACAGTGTACACGG + Intergenic
940286624 2:152038836-152038858 TTTCCTGTCCAGAGTGTCCTGGG - Intronic
943509750 2:188809941-188809963 TTTCTTGGTAATAGTGTGCATGG - Intergenic
943558733 2:189436057-189436079 TATCCTGGTGATAGTTTGCTGGG - Intergenic
944019873 2:195089211-195089233 TGTCCTTGCGATAGTTTGCTCGG - Intergenic
944249061 2:197562768-197562790 TGTCCTTGCGATAGTTTGCTCGG + Intergenic
944434671 2:199674465-199674487 TTATTTGGAAATAGTGTGCTGGG - Intergenic
947164680 2:227249950-227249972 TTACCTGCCAATTATGTGCTAGG + Intronic
947284667 2:228500152-228500174 TTTCCTGGGTATAGAATGCTGGG + Intergenic
948257990 2:236582565-236582587 TTTTCAGGCAATAGTGTTTTTGG + Intergenic
1172764533 20:37344553-37344575 TTTACTGGCCATACTGGGCTCGG - Intergenic
1180654544 22:17408612-17408634 TGTCCTGGGATTGGTGTGCTTGG + Intronic
1184339132 22:43876177-43876199 TGTCTTGGCAGGAGTGTGCTTGG - Intergenic
950137800 3:10594447-10594469 TGTCCTTGCGATAGTTTGCTGGG - Intronic
951536022 3:23741601-23741623 TTTCCTGAAAATAGTATCCTTGG + Intergenic
951900106 3:27648538-27648560 TTTCCAGGCAATAGGCTGCCTGG - Intergenic
953892947 3:46768281-46768303 TTTGCTGGCAATAGTATTCTTGG - Intronic
954774837 3:53007499-53007521 TTTTCTGGCACAAGTGTTCTAGG - Intronic
954847265 3:53570856-53570878 CTTCCTGGAAAAAGTGAGCTTGG + Intronic
954985735 3:54790073-54790095 TTTCCTGGCTGGAGTGTACTAGG + Intronic
957310574 3:78513367-78513389 TGTCCTTGCGATAGTTTGCTCGG - Intergenic
957635283 3:82775641-82775663 TTTGCTGGATATAGTGTGCTTGG - Intergenic
960001234 3:112734108-112734130 CTTCCTGGTAATAGTGGGCCTGG + Intergenic
961458537 3:127036131-127036153 TTTCCTGGCTATGGTGGGGTGGG + Exonic
963016590 3:140829581-140829603 TTTCTTGGAAGAAGTGTGCTAGG - Intergenic
964766221 3:160180663-160180685 TTTCCTGGCAGTAGAGTTTTAGG + Intergenic
966518020 3:180841179-180841201 TTTGCTGGGTATAGTGTTCTTGG - Intronic
967034527 3:185638288-185638310 TTTCCTGGAAATGGGCTGCTGGG + Intergenic
969473730 4:7408357-7408379 TTTGCTGGCTATAGTATTCTTGG + Intronic
970687924 4:18589446-18589468 TGTCCTTGCGATAGTTTGCTGGG + Intergenic
970975165 4:22035110-22035132 TGTCCTTGCAGTAGTTTGCTCGG + Intergenic
972635458 4:40879994-40880016 TTTCCTTGAAATATTGTCCTGGG - Intronic
972845258 4:42981686-42981708 TTTGCTGGCTATAGTATTCTTGG + Intronic
974650316 4:64746908-64746930 TTTTATGTCAATTGTGTGCTTGG + Intergenic
974947745 4:68548305-68548327 TGTCCTTGCGATAGTTTGCTGGG - Intronic
975869252 4:78760079-78760101 TGTCCTTGCGATAGTTTGCTGGG - Intergenic
976310983 4:83613230-83613252 TTTCCTGGGTATAGTATTCTTGG + Intergenic
978207622 4:106097374-106097396 TTTCATGACAAGAGTGTTCTTGG - Intronic
978517090 4:109580140-109580162 TGTCCTTGCAATAGTTTGCTCGG + Intronic
980555103 4:134393675-134393697 TTTCATGCCAAAAGTTTGCTAGG + Intergenic
980610039 4:135148441-135148463 CCTCCTTGCAATAGTTTGCTCGG + Intergenic
982369026 4:154613173-154613195 ATTCCTGGGAATAGTGAACTGGG - Intergenic
983901095 4:173135464-173135486 GTTCCAGGCTATAGTGAGCTAGG - Intergenic
985148185 4:186916664-186916686 TTTCCTAGCAAGTGTGAGCTGGG + Intergenic
985388550 4:189470270-189470292 TTTCCCGCCAAAAGTGTGCCAGG + Intergenic
986390376 5:7280285-7280307 TTACCTGGCAATAGCTTGGTGGG + Intergenic
986607788 5:9539513-9539535 TTCCCTGGAATTTGTGTGCTTGG + Intronic
987200034 5:15567857-15567879 TGTCCTTGCGATAGTTTGCTGGG + Intronic
987813924 5:22876011-22876033 ATTCCTGCCAATAGTGTACGAGG + Intergenic
987953177 5:24702624-24702646 TGTCCTTGCAATAGTTTGCTGGG + Intergenic
988800570 5:34692785-34692807 TTGCCTGGTATTAGTTTGCTAGG + Intronic
989151244 5:38301832-38301854 TTGCCTGGCAATAAGATGCTTGG - Intronic
994062007 5:95488560-95488582 TTTGCTGGGTATAGTGTCCTTGG - Intronic
994688272 5:102983917-102983939 TTTGCTGGGAATAGTATTCTTGG - Intronic
994931321 5:106189479-106189501 TTTCTTGGCAATATTGTGGAGGG + Intergenic
996675135 5:126166539-126166561 TTTTCTGGCTATAGTATTCTTGG + Intergenic
997191359 5:131939191-131939213 TTGCCTGGCCACAGTGTGTTAGG + Intronic
998299343 5:141002960-141002982 TTTCCTGAAAATAGTATCCTTGG + Intronic
1004321799 6:14637528-14637550 TTGCATGGCAAGAGTGTGCAAGG - Intergenic
1004676035 6:17843316-17843338 TTTCCTGGAAGCAATGTGCTGGG + Intronic
1006838784 6:37015032-37015054 TTTCTTGGTAAGAGGGTGCTGGG + Exonic
1007940028 6:45771854-45771876 TTTCCTGGAAATAGTTTCCACGG - Intergenic
1007999620 6:46346415-46346437 TTTACTGGTAATATTATGCTTGG + Intronic
1008835094 6:55817480-55817502 TGTCCTTGCGATAGTTTGCTGGG - Intronic
1010857368 6:80857293-80857315 TGTCCTTGCGATAGTATGCTAGG + Intergenic
1011257305 6:85435908-85435930 TTTCCAGGCAAAATTGTGTTTGG - Intergenic
1012613803 6:101250132-101250154 TTTCCTGGAAACAGTATTCTTGG - Intergenic
1018147656 6:160908130-160908152 TTTTCTGGACATAGTGTTCTAGG - Intergenic
1018332306 6:162742980-162743002 ATTCCTGCCAACAGTGTGCAAGG + Intronic
1018342835 6:162869451-162869473 TTTCCTGACAATAGTCTGAATGG - Intronic
1018957749 6:168421951-168421973 ATTCCCACCAATAGTGTGCTGGG + Intergenic
1019079319 6:169419216-169419238 TTTCCTATCAGTAGTTTGCTAGG + Intergenic
1019263644 7:98628-98650 TTTGCTGGATATAGTGTTCTTGG - Intergenic
1020524833 7:9245825-9245847 TGTCCTTGCGATAGTTTGCTGGG - Intergenic
1021922871 7:25504445-25504467 TTTCCTGACAATGATGTGTTTGG + Intergenic
1023260671 7:38354917-38354939 TGTCCTTGGAATAGTTTGCTCGG - Intergenic
1023261653 7:38364061-38364083 TGTCCTTGGAATAGTTTGCTCGG - Intergenic
1024232624 7:47374221-47374243 TTATCTGGCCACAGTGTGCTTGG + Intronic
1024595205 7:50927350-50927372 TTTCCTTGGAAAAGTGTACTAGG + Intergenic
1027944662 7:84729324-84729346 TTTCCTGGCTCCAGTTTGCTTGG - Intergenic
1029873260 7:103718597-103718619 TTTCATGGCAAGAGGGGGCTTGG - Intronic
1030701960 7:112649820-112649842 TTTCCTGGGTATAGTATTCTTGG - Intergenic
1030775777 7:113532568-113532590 TTTGCTGGTAATAGTATTCTTGG - Intergenic
1031235208 7:119167151-119167173 TTTCCTGGCTATATTATTCTTGG + Intergenic
1031971217 7:128066351-128066373 TTTTCTGGCATTGGAGTGCTAGG - Intronic
1032327096 7:130939664-130939686 TTTCCTGCCAGTAGTGCCCTTGG + Intergenic
1034856651 7:154555346-154555368 TGTCCTTGCAATAGTTTGCTGGG - Intronic
1034870246 7:154677203-154677225 TATCCTTGGAATAGTTTGCTTGG - Intronic
1036693814 8:10961648-10961670 CTTCCTGGCAACACTGTGCACGG + Intronic
1038218490 8:25585156-25585178 TTTCTTGGCAACTGTGAGCTGGG + Intergenic
1039335918 8:36589247-36589269 TTTGCTCTAAATAGTGTGCTGGG + Intergenic
1043819493 8:84844848-84844870 TGTCCTTGCCATAGTTTGCTGGG - Intronic
1045124777 8:99077494-99077516 TTTGCTGGAAATAGTTTTCTTGG + Intronic
1045549124 8:103154453-103154475 TTACCTGGCAATAATGTGAAGGG - Intronic
1046260896 8:111766095-111766117 TGTCCTGGAAAAAGTGGGCTTGG - Intergenic
1046308810 8:112405774-112405796 TTTTCTGGAAATATTTTGCTTGG - Intronic
1046371826 8:113319167-113319189 ATTCCCGCCAATAGTGTACTAGG + Intronic
1047538763 8:125743651-125743673 TTTACTGGCATTGGTTTGCTTGG - Intergenic
1049776430 8:144407962-144407984 CCTCCTGCCAATAGTGTGTTAGG + Intronic
1050333023 9:4564234-4564256 GTACCAGGCAATAGTGTGATGGG - Intronic
1051982131 9:23033090-23033112 TTTGCTGGCAGTAGTATTCTTGG - Intergenic
1053595396 9:39556139-39556161 CTTCCCAGCAATAATGTGCTGGG - Intergenic
1053853360 9:42312779-42312801 CTTCCCAGCAATAATGTGCTGGG - Intergenic
1054570856 9:66808833-66808855 CTTCCCAGCAATAATGTGCTGGG + Intergenic
1054841606 9:69747671-69747693 CTACCTGGCAATAGTTGGCTGGG - Intronic
1055226594 9:74004628-74004650 TGTCCTTGCGATAGTTTGCTCGG + Intergenic
1055662741 9:78521416-78521438 TTTTCTGGCTATAGTATCCTTGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1061523123 9:131133844-131133866 TTTAATGCCAACAGTGTGCTAGG + Intronic
1062445590 9:136592842-136592864 AGTCCAGGCAAGAGTGTGCTGGG + Intergenic
1185928419 X:4172859-4172881 CTTCCTGGCAACAGTGTGATAGG + Intergenic
1187403246 X:18981256-18981278 TTTCCCGGCAGAACTGTGCTGGG + Intronic
1187654963 X:21461641-21461663 TTTCCTGGCAGTAGTTTCATAGG + Intronic
1188236071 X:27732827-27732849 TTTCCTACCAACAGTGTGCAAGG + Intronic
1188951918 X:36386854-36386876 TATCTTGGCAAGAGTGAGCTGGG - Intergenic
1191781889 X:64877967-64877989 TTTCCTACCAACAGTGTGCAAGG - Intergenic
1192000231 X:67142005-67142027 TGTCCTTGCAATAGTTTACTGGG + Intergenic
1192241955 X:69339023-69339045 TGTCCTTGCGATAGTTTGCTGGG + Intergenic
1193293804 X:79809712-79809734 CATCCTGTCTATAGTGTGCTGGG + Intergenic
1194036518 X:88880542-88880564 TTTCCCAGCAACAGTGTGCAAGG + Intergenic
1194632413 X:96301581-96301603 TTTTCTTGCATTAGTTTGCTAGG - Intergenic
1198526403 X:137505575-137505597 ATTCCTATCAATAGTGTGCAGGG - Intergenic
1198926983 X:141808694-141808716 ATTCCTGCCAAAAGTGTGCAAGG + Intergenic
1201529024 Y:14971408-14971430 TGTCCTTGCAATAGTTTGCTGGG + Intergenic
1202051924 Y:20790432-20790454 TTTTCGGGCAATAGTGTGTCTGG + Intergenic
1202260169 Y:22962029-22962051 TTTCCTGTCTTTAGTGGGCTTGG + Intergenic
1202262850 Y:22987743-22987765 TTTCCTGGCAATAGTGTGCTTGG + Exonic
1202413156 Y:24595770-24595792 TTTCCTGTCTTTAGTGGGCTTGG + Intergenic
1202415840 Y:24621484-24621506 TTTCCTGGCAATAGTGTGCTTGG + Exonic
1202454947 Y:25048602-25048624 TTTCCTGGCAATAGTGTGCTTGG - Exonic
1202457626 Y:25074298-25074320 TTTCCTGTCTTTAGTGGGCTTGG - Intergenic