ID: 1202416908

View in Genome Browser
Species Human (GRCh38)
Location Y:24632053-24632075
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 4, 1: 0, 2: 2, 3: 16, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202416908_1202416913 1 Left 1202416908 Y:24632053-24632075 CCATCGTGGCTCTGCCTTCAAAG 0: 4
1: 0
2: 2
3: 16
4: 231
Right 1202416913 Y:24632077-24632099 GAAATTTTACATATGTCACTGGG 0: 4
1: 0
2: 2
3: 19
4: 336
1202416908_1202416912 0 Left 1202416908 Y:24632053-24632075 CCATCGTGGCTCTGCCTTCAAAG 0: 4
1: 0
2: 2
3: 16
4: 231
Right 1202416912 Y:24632076-24632098 GGAAATTTTACATATGTCACTGG 0: 4
1: 0
2: 1
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202416908 Original CRISPR CTTTGAAGGCAGAGCCACGA TGG (reversed) Exonic
901801416 1:11710247-11710269 CTTAGAAGGCCAAGGCACGAGGG + Intronic
902235140 1:15052703-15052725 CTTCCAAGGCAGAGCTACAATGG - Intronic
902511988 1:16971661-16971683 CTTAGAAGGCTGGGCCAGGATGG + Intronic
902621398 1:17652975-17652997 CTATGAGGGCAGAGCCATCAAGG - Intronic
903367674 1:22815132-22815154 CATTGACGGCAGAGCCATGTGGG + Intronic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
911666737 1:100561668-100561690 CTTTGAATGAAGAGCAAAGAAGG + Intergenic
912382323 1:109254261-109254283 CTTTGAGGGCAGAGACCCCAAGG + Intronic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
916741056 1:167647343-167647365 CTTTGAAGGCTGAGGCAGGGTGG + Intronic
919495253 1:198257500-198257522 GATTGAAGGCAGAGCCACAGAGG - Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
922158887 1:223063334-223063356 CTGTGATGGCATAGCCACGCTGG + Intergenic
924582475 1:245334393-245334415 CTTTGAAGGCAAAGAAATGAAGG - Intronic
1063351398 10:5359347-5359369 AATTAAAAGCAGAGCCACGACGG + Intergenic
1063823426 10:9864501-9864523 TTTTGAAGGGAATGCCACGAGGG - Intergenic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1065938339 10:30541667-30541689 CTTTGAAGCCAAATCCACCAGGG + Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066546024 10:36501602-36501624 CATTGAAGGCACAGCAAGGATGG - Intergenic
1067370016 10:45673852-45673874 CTTTGAGGACAGAGCTATGATGG + Intergenic
1069036594 10:63651899-63651921 CTTTGGCGGCTGAGGCACGAGGG + Intergenic
1069277182 10:66607212-66607234 CTGCCAAGACAGAGCCACGAAGG + Intronic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1072095995 10:92180517-92180539 CTACAAAGGCAGAGCCACAAAGG - Intronic
1072306052 10:94108276-94108298 CTTTGAAGGAAGAGTCAGGGAGG + Intronic
1072493866 10:95935299-95935321 CTTTGAAGGCAGAACCAACAGGG - Intronic
1072605248 10:96975905-96975927 CTTGGGAGGCTGAGCCAGGAGGG + Intronic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1073717483 10:106123694-106123716 TTTTGAAGGCTGAGCCATCAAGG - Intergenic
1074105895 10:110389439-110389461 CTGTGAAGGCAGAGCCTCATGGG - Intergenic
1074436871 10:113441847-113441869 CTTGGAAGGCAGGGCCATGAGGG + Intergenic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075290337 10:121224494-121224516 CTTTGGAGCAAGAGCCAGGAGGG - Intergenic
1075977201 10:126706290-126706312 CTGTGAGGGCAGAGCCAGCAGGG + Intergenic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1077994122 11:7438619-7438641 CTTTCAAGGCTGAGCCAGGTTGG - Intronic
1077997720 11:7468320-7468342 CTTTGATGGCAGATCTAAGAAGG + Exonic
1081433863 11:43005500-43005522 TTTGGAAGGTAGAGCCAAGATGG - Intergenic
1081875035 11:46402693-46402715 CTTTGAGGGAAGAGACACAATGG + Intronic
1081968378 11:47183055-47183077 CCTTCAAGGCAGAGTCACGGTGG - Exonic
1082185284 11:49172550-49172572 CTTTGAAGTCATAGCAACTAGGG - Intronic
1084610947 11:70202643-70202665 CATTGCAGGCTGAGCCACCACGG + Intergenic
1085267446 11:75245639-75245661 CCTTGAAGGAAGAGTCAGGAAGG + Intergenic
1086681042 11:89672793-89672815 CTTTGAAGTCATAGCAACTAGGG + Intergenic
1088117534 11:106329451-106329473 TTTTGAAGGTAGAGCCAGCAGGG + Intergenic
1089150113 11:116357835-116357857 CTTGGAAGGCAGGGCCACTTTGG - Intergenic
1091133046 11:133162660-133162682 CTTTGCAGTTACAGCCACGAGGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1093156508 12:15692361-15692383 CATTGAAGACAGAACCACAAGGG - Intronic
1095393682 12:41739582-41739604 CCATGAAGGCAGTGCCATGATGG - Intergenic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1101491372 12:105212800-105212822 CTCTGAAGCCACAGCCTCGAAGG - Intronic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1109395562 13:61754110-61754132 ATTTGAAGACAGAGCCTCAAAGG - Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1114933636 14:27506711-27506733 CATTGAAGTCAGAGCCTTGAGGG - Intergenic
1117497237 14:56317924-56317946 CTTAAAGGGCAGAGCCAGGATGG + Intergenic
1117636885 14:57753662-57753684 CTTTGAGGGCAGCACCAAGAAGG + Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1119523294 14:75302099-75302121 CTTTGGAGGCCGAGACAGGAGGG + Intergenic
1121013871 14:90536625-90536647 TTCTGAAGACAGAGCCAAGAGGG - Exonic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1122381895 14:101313710-101313732 CAATGAAGGAAGAGCCATGAAGG - Intergenic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1128229462 15:66024705-66024727 CTCTGAAGCCAGAGCTACCAGGG - Intronic
1129742099 15:77994276-77994298 CTTGGAAGGGAGTGCCACCAGGG - Intronic
1129843384 15:78757193-78757215 CTTGGAAGGGAGTGCCACCAGGG + Intergenic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1137319104 16:47360819-47360841 CTTTGAAATCAGCTCCACGATGG + Intronic
1139114209 16:63929463-63929485 TTTTGAAGGCATTGCCAAGATGG - Intergenic
1140258884 16:73360029-73360051 CTTTGAAGGCAGAGAGATGTGGG + Intergenic
1141446617 16:84062928-84062950 CTTTGTGGGCACTGCCACGAGGG - Intronic
1143122632 17:4618409-4618431 CTTTGGAGCCAGAGACACCAAGG + Intergenic
1143361979 17:6379056-6379078 CTCAGATGGCAGAGCCACGATGG + Intergenic
1146505186 17:33398817-33398839 CATTGAAGACAGAACCAAGATGG + Intronic
1146854560 17:36252099-36252121 TTTTGGAGGCAGAGCCTCCAGGG - Intronic
1146866060 17:36336277-36336299 TTTTGGAGGCAGAGCCTCCAGGG + Intronic
1146870460 17:36375991-36376013 TTTTGGAGGCAGAGCCTCCAGGG - Intronic
1146877817 17:36427072-36427094 TTTTGGAGGCAGAGCCTCCAGGG - Intronic
1147068930 17:37936889-37936911 TTTTGGAGGCAGAGCCTCCAGGG + Intergenic
1147073343 17:37976615-37976637 TTTTGGAGGCAGAGCCTCCAGGG - Intergenic
1147080454 17:38016426-38016448 TTTTGGAGGCAGAGCCTCCAGGG + Intronic
1147084864 17:38056153-38056175 TTTTGGAGGCAGAGCCTCCAGGG - Intronic
1147096401 17:38140386-38140408 TTTTGGAGGCAGAGCCTCCAGGG + Intergenic
1147100812 17:38180119-38180141 TTTTGGAGGCAGAGCCTCCAGGG - Intergenic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1149769185 17:59306605-59306627 CTTAGGAGGCAGAGACAGGAGGG + Intergenic
1149845402 17:60006583-60006605 TTTTGGAGGCAGAGCCCCCAGGG - Intergenic
1150083750 17:62263166-62263188 TTTTGGAGGCAGAGCCCCCAGGG - Intergenic
1150580441 17:66468980-66469002 CTTTCTAGTCAGAGCCAAGAAGG + Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151326855 17:73385032-73385054 CCTTGAAGACAAAGCCAGGAGGG - Intronic
1151517809 17:74607666-74607688 CGTGGAAGGCAGAGCCATGGAGG + Intergenic
1151891916 17:76956170-76956192 CTTGGAGGGCAAAGCCATGAGGG - Intergenic
1151929940 17:77225947-77225969 CCTTGGAGTCAGAGCCACGAGGG + Intergenic
1153094319 18:1383413-1383435 CTTTGCAGACAGAGCCTTGATGG + Intergenic
1157125972 18:44956242-44956264 CTTTGGGGGCACAGCCATGAAGG - Intronic
1158423629 18:57319320-57319342 CTTTTAATGGAGACCCACGATGG - Intergenic
1159082448 18:63751076-63751098 ATTTGAAGGCAGAGTGACAAGGG - Intergenic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1161933071 19:7354065-7354087 CTTTGGAGGCTGAGCCAGGAGGG + Intronic
1165014182 19:32868837-32868859 CTTTCAAGGCACAGGCACGTGGG - Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1166154192 19:40898454-40898476 CTTTGAGGACAGAGCCAAGCAGG - Intergenic
1166173912 19:41052126-41052148 CTTTGAGGACAGAGCCAAGCAGG + Intergenic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
926392972 2:12413111-12413133 CTTTGAAGTCAGAGGCACTGGGG - Intergenic
926681074 2:15664776-15664798 CTTTGCAGGCCGGGCCACGACGG + Intergenic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
931726214 2:65113396-65113418 CTTAGAAGGCTGAGGCAGGAGGG + Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
933730457 2:85452339-85452361 TTTTGAAGGTAGAGCCAACAGGG - Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
937494345 2:122401990-122402012 ATTTGGAGGCAGATCCAGGAAGG - Intergenic
938054850 2:128207416-128207438 CTTGGGAGGCTGAGGCACGAGGG - Intergenic
938942743 2:136183181-136183203 CTTTCAAGCCAGTGCCCCGAAGG - Intergenic
941321619 2:164062812-164062834 CTGTGATGGCAGAACCATGAGGG + Intergenic
942227685 2:173831488-173831510 CTTTGAAGACAGCGCCGAGAGGG + Intergenic
944681853 2:202084394-202084416 CTCTGAATGCAGAGGCATGAAGG - Intronic
945184146 2:207122682-207122704 CTTTGGAGGCACAGCCCAGAAGG + Intronic
945348907 2:208752627-208752649 TTTTGAAGGAGGAGCCAAGATGG - Intronic
945723260 2:213445552-213445574 CTTTGGAGGCTGAGGCAGGAGGG + Intronic
945870379 2:215220240-215220262 CTTGGAAGGAGGAGCCAAGATGG + Intergenic
948295390 2:236856649-236856671 CATGGAAGCCTGAGCCACGATGG - Intergenic
1168758491 20:332393-332415 TTTTGAAGGTAGAGCCAACAGGG - Intergenic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169962266 20:11174504-11174526 CTTTGGCGGCAGAACCACGTAGG + Intergenic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1173853689 20:46235700-46235722 CATTGAAGGTAGAGCCAACAGGG - Intronic
1173926681 20:46786181-46786203 CTTTGCAGTCACAGCCACGTGGG - Intergenic
1174587644 20:51621414-51621436 ATCTGAAACCAGAGCCACGATGG - Intronic
1177382042 21:20356747-20356769 CTTGCAACGCAGAGCCATGAAGG - Intergenic
1177824607 21:26068465-26068487 CTTGGAAGGCTGAGACAGGAAGG - Intronic
1177948605 21:27505103-27505125 CTTGGAAGGCTGAGACAGGAGGG + Intergenic
1177989808 21:28023457-28023479 CTTTGAAGACAAAGGCAAGAAGG - Intergenic
1178341424 21:31788570-31788592 CTTTGGAGGCTGAGACAAGAGGG + Intergenic
1178827397 21:36028337-36028359 CTCTGTGGGCAGAGCCAGGATGG + Intergenic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1181084503 22:20433236-20433258 CTGAGAAGGAAGAGCCACCAAGG + Intronic
1181603166 22:23964285-23964307 CTTTGAAAGCGGACCCACGGTGG + Intergenic
1181605348 22:23977022-23977044 CTTTGAAAGCAGACCCACGGTGG - Intronic
1182037086 22:27207448-27207470 CGGTCAAGGCAGAGCCACAAGGG + Intergenic
1182596021 22:31421219-31421241 CTTAGAAGGCTGAGGCAGGAGGG - Intronic
1182936739 22:34229972-34229994 ATTTGAAGGCAGAGCCACAATGG - Intergenic
1184835034 22:47016010-47016032 CTGGGATGGCAGAGCCACTAAGG + Intronic
950201645 3:11048588-11048610 TTTCTAAGGCAGAGCCAGGAGGG + Intergenic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953853616 3:46484546-46484568 CTGGGAAGGCAGTGCCAAGAAGG + Intronic
954305070 3:49721339-49721361 CTTTGAACCCAGAGCCAGGCTGG + Exonic
954726293 3:52613745-52613767 TTTAGAAGGCAGAGGCAGGAGGG + Intronic
955715210 3:61822365-61822387 CTCTGAAGTCAGGGACACGAGGG - Intronic
959075331 3:101743501-101743523 CTTGGAAGGCTGAGACAGGACGG - Intronic
959452455 3:106520409-106520431 CTTTAAAGGCAGAGTAATGAAGG + Intergenic
959685156 3:109137316-109137338 CTTTAAAGGCAGATCAAGGAAGG + Intergenic
960318831 3:116209408-116209430 ATTTGAGGGAAGAGCCAAGATGG - Intronic
962492620 3:135908838-135908860 CTTTGCAGGGAGAGCCACAAAGG - Intergenic
963136623 3:141911600-141911622 CTTGGAAGGCTGAGGCATGAGGG - Intronic
964096412 3:152936399-152936421 TTTTGAAGGCAGAGCTAACAAGG - Intergenic
964637895 3:158877666-158877688 CGTTGAAGGCAGGGCCACCAAGG - Intergenic
965553958 3:170000405-170000427 CTGTGAAGGCAGAGCCCTTATGG + Intergenic
967303939 3:188042728-188042750 AGTTGAAGGCAGAGTCAGGATGG - Intergenic
969706869 4:8816596-8816618 CTTTGAAGGCAGGGTCATGCTGG + Intergenic
969979736 4:11142291-11142313 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
970371650 4:15413046-15413068 CTTTGAAGTCAGAGCCACCTGGG - Intronic
971137529 4:23886167-23886189 CTTGGAAGGCAGGGCCATGAGGG - Intronic
972150002 4:36077556-36077578 TTTTGAAGGTAGAGCCAATAAGG - Intronic
972405382 4:38741559-38741581 CTTAGAAGGCTGAGGCAGGAGGG - Intergenic
976067731 4:81208527-81208549 CTCTGAAGGCTGAGGCAAGAGGG - Intronic
980295638 4:130912454-130912476 ATTCGAAGTCAGAGCCACTATGG - Intergenic
981197967 4:141942794-141942816 ATTTGAAGCCAGAGCCACCTTGG + Intergenic
981807674 4:148735541-148735563 TTTTTAAGGTAGAGCCACTAGGG - Intergenic
982781380 4:159494582-159494604 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
983808705 4:172029685-172029707 CTTTGGAGTCACAGCCACTAGGG - Intronic
984175216 4:176409229-176409251 CATTGAAGGTGGAGCCAGGAAGG + Intergenic
984710701 4:182881640-182881662 CTTGGAAGGCAGAGCTGCGGGGG + Intergenic
984829237 4:183955844-183955866 CTCTGCAGGCAGGCCCACGAGGG - Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985184395 4:187300163-187300185 TTTTGAAGGCAGAGACACCCAGG - Intergenic
985846620 5:2354259-2354281 CTTAGCAGGCAGAGCCAAGGAGG - Intergenic
986128263 5:4903897-4903919 CATTGAAGGGAGAGACAGGAAGG - Intergenic
986475069 5:8121264-8121286 CTTGGAAGACGGAGCCATGAGGG + Intergenic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
988121592 5:26970688-26970710 CAGTGAAGGCAGAGCAATGAAGG - Intronic
988994223 5:36698913-36698935 CTTTGAAGGTAGTGCTAGGAGGG + Intergenic
990315406 5:54578445-54578467 CCTTGGAGGCAGAGCCACTAAGG - Intergenic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997489057 5:134257474-134257496 CTTTTAAGGAAGAGCAATGATGG + Intergenic
1000828984 5:166080508-166080530 TTTTGGAGGCAGAGGCAGGAAGG - Intergenic
1001474738 5:172042459-172042481 ATGTGAAGGACGAGCCACGAGGG + Exonic
1005229550 6:23684500-23684522 CTTTGTAGGCACAGCCATGGGGG - Intergenic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009642045 6:66350480-66350502 CTTTGAAGGCACAGCTAAGGTGG + Intergenic
1016139043 6:140585723-140585745 ATGAGAAGGCAGAGCCAAGATGG + Intergenic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1026177596 7:68011605-68011627 CTTAGCAGGCAGAGCTAGGAAGG + Intergenic
1028583786 7:92433693-92433715 CTTTGAGGGCAGAGACAGCAAGG - Intergenic
1033664915 7:143431296-143431318 CTGTAAAGGCAGACCCAGGATGG - Intergenic
1035559394 8:593516-593538 CTGTGAGGGGAGCGCCACGAGGG + Intergenic
1036438674 8:8760410-8760432 CTTTGAAGGCATATCCCCCAGGG - Intergenic
1036467431 8:9013845-9013867 TTTTGAAGGCAGAGCCAAACAGG - Intronic
1039217566 8:35289874-35289896 CTTGGAAGGCTGAGACAGGAGGG + Intronic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1049418025 8:142504398-142504420 CTGTGCAGGCAGGGCCACCAGGG + Intronic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1051819280 9:21145672-21145694 CTTTGTAGACAGAGCAACGGGGG + Intergenic
1055042298 9:71887736-71887758 CTTTGATGGAAAAGCCAGGAAGG - Intronic
1055114688 9:72593885-72593907 CTTTGATGGAAGAGCAACAAAGG - Intronic
1056376864 9:86023151-86023173 CTTGGAAAGGAGAGCCAAGAGGG - Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1058987204 9:110219350-110219372 CTTTGATGTCAGAGCCACCTGGG - Intergenic
1060877927 9:127096491-127096513 CTTTGAAGGAGGCGCCACGTAGG + Intronic
1061901051 9:133672222-133672244 CTTAGAAGACAGAGACACAAAGG - Intronic
1062174325 9:135152637-135152659 CTTGGAAGGCAGAGCTCCCAGGG + Intergenic
1062449068 9:136608048-136608070 CTTTGAGGACAAAGCCATGAGGG - Intergenic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1187082709 X:16007838-16007860 CTTTGAAGGCTGAGCCACTTGGG - Intergenic
1187424206 X:19162513-19162535 CTTTGGAGGCCGAGGCAGGAGGG - Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1195118946 X:101729896-101729918 CTTTGAAGTCAGACCCAGGTTGG - Intergenic
1196068724 X:111495554-111495576 CTTTGAACAAAGAGCCACAAGGG - Intergenic
1198381016 X:136083317-136083339 CTTTGGAGGTACAGCCACAAAGG + Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1200879055 Y:8193463-8193485 CTTTGAGGGTGGAGCCATGATGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic