ID: 1202423216

View in Genome Browser
Species Human (GRCh38)
Location Y:24698809-24698831
Sequence CCGTGGTGGCATGCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202423216_1202423220 -8 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423220 Y:24698824-24698846 CACCACGGTCAGCAAGATTTGGG No data
1202423216_1202423223 -6 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423223 Y:24698826-24698848 CCACGGTCAGCAAGATTTGGGGG No data
1202423216_1202423225 11 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423225 Y:24698843-24698865 TGGGGGTTTTTGTAGAGACAGGG No data
1202423216_1202423221 -7 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423221 Y:24698825-24698847 ACCACGGTCAGCAAGATTTGGGG No data
1202423216_1202423224 10 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423224 Y:24698842-24698864 TTGGGGGTTTTTGTAGAGACAGG No data
1202423216_1202423219 -9 Left 1202423216 Y:24698809-24698831 CCTGCAGGTGCATGCCACCACGG No data
Right 1202423219 Y:24698823-24698845 CCACCACGGTCAGCAAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202423216 Original CRISPR CCGTGGTGGCATGCACCTGC AGG (reversed) Intergenic
No off target data available for this crispr