ID: 1202424003

View in Genome Browser
Species Human (GRCh38)
Location Y:24707630-24707652
Sequence GGGCGAAGGATGCTGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202423994_1202424003 13 Left 1202423994 Y:24707594-24707616 CCCTCAAAGAAAGCCAGGATGCT No data
Right 1202424003 Y:24707630-24707652 GGGCGAAGGATGCTGAGCATGGG No data
1202423995_1202424003 12 Left 1202423995 Y:24707595-24707617 CCTCAAAGAAAGCCAGGATGCTG No data
Right 1202424003 Y:24707630-24707652 GGGCGAAGGATGCTGAGCATGGG No data
1202423997_1202424003 0 Left 1202423997 Y:24707607-24707629 CCAGGATGCTGGCACCAGAAAAA No data
Right 1202424003 Y:24707630-24707652 GGGCGAAGGATGCTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202424003 Original CRISPR GGGCGAAGGATGCTGAGCAT GGG Intergenic
No off target data available for this crispr