ID: 1202425689

View in Genome Browser
Species Human (GRCh38)
Location Y:24719836-24719858
Sequence TCAAGCGGGCCCGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202425678_1202425689 4 Left 1202425678 Y:24719809-24719831 CCTGCCAAGCCCACACCCACCCG 0: 26
1: 421
2: 518
3: 423
4: 706
Right 1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG No data
1202425680_1202425689 0 Left 1202425680 Y:24719813-24719835 CCAAGCCCACACCCACCCGGAAC 0: 63
1: 709
2: 625
3: 344
4: 428
Right 1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG No data
1202425681_1202425689 -5 Left 1202425681 Y:24719818-24719840 CCCACACCCACCCGGAACTCAAG No data
Right 1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG No data
1202425682_1202425689 -6 Left 1202425682 Y:24719819-24719841 CCACACCCACCCGGAACTCAAGC No data
Right 1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG No data
1202425677_1202425689 15 Left 1202425677 Y:24719798-24719820 CCGAGTGCGGGCCTGCCAAGCCC No data
Right 1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202425689 Original CRISPR TCAAGCGGGCCCGCAAGCGC CGG Intergenic
No off target data available for this crispr