ID: 1202426027

View in Genome Browser
Species Human (GRCh38)
Location Y:24722358-24722380
Sequence TTACACAGCTTGGAAATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202426027_1202426035 23 Left 1202426027 Y:24722358-24722380 CCTCTCATTTCCAAGCTGTGTAA No data
Right 1202426035 Y:24722404-24722426 CTCCAAACATCAGTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202426027 Original CRISPR TTACACAGCTTGGAAATGAG AGG (reversed) Intergenic
No off target data available for this crispr