ID: 1202428837

View in Genome Browser
Species Human (GRCh38)
Location Y:24752598-24752620
Sequence CAGTTTAGCCTCAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202428837_1202428847 19 Left 1202428837 Y:24752598-24752620 CCTTCATCCCTGAGGCTAAACTG No data
Right 1202428847 Y:24752640-24752662 CTAGTGACTGAACATCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202428837 Original CRISPR CAGTTTAGCCTCAGGGATGA AGG (reversed) Intergenic
No off target data available for this crispr