ID: 1202429527

View in Genome Browser
Species Human (GRCh38)
Location Y:24760269-24760291
Sequence GCATTTTTAACATGTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202429527_1202429533 26 Left 1202429527 Y:24760269-24760291 CCTGGGGCACATGTTAAAAATGC No data
Right 1202429533 Y:24760318-24760340 AGAATAAGAGCATCTGAGAATGG No data
1202429527_1202429534 27 Left 1202429527 Y:24760269-24760291 CCTGGGGCACATGTTAAAAATGC No data
Right 1202429534 Y:24760319-24760341 GAATAAGAGCATCTGAGAATGGG No data
1202429527_1202429535 28 Left 1202429527 Y:24760269-24760291 CCTGGGGCACATGTTAAAAATGC No data
Right 1202429535 Y:24760320-24760342 AATAAGAGCATCTGAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202429527 Original CRISPR GCATTTTTAACATGTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr