ID: 1202432064

View in Genome Browser
Species Human (GRCh38)
Location Y:24793389-24793411
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 8, 1: 0, 2: 12, 3: 22, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900012150 1:124025-124047 CTATATAAAAAACTGAAGAAAGG - Intergenic
900042210 1:480015-480037 CTATATAAAAAACTGAAGAAAGG - Intergenic
900063650 1:715011-715033 CTATATAAAAAACTGAAGAAAGG - Intergenic
900271830 1:1794208-1794230 CAATATCCACACATGATGACTGG + Intronic
901308257 1:8249306-8249328 CTATCTCCAAAAAAGAAAAAAGG + Intergenic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904679323 1:32217888-32217910 CTATATCCACAGTTTAATAACGG - Intronic
905269177 1:36775731-36775753 TTTTATTCACAAATTAAGAAAGG - Intergenic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
908608295 1:65825230-65825252 CAATGTCCACAATTGAAAAAGGG - Intronic
909288546 1:73853153-73853175 ATATATCCTCAAATGAAAACTGG - Intergenic
909561929 1:77016788-77016810 CTACATCCACAAAAGGGGAAAGG + Intronic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
910070194 1:83204604-83204626 CTATCTCAATAACTGAAGAAAGG + Intergenic
910293237 1:85618668-85618690 CTATCTCCAAAAATGAAGTTGGG + Intergenic
911381030 1:97115046-97115068 CTCTATTCACAACTGAAAAAAGG + Intronic
911806428 1:102214240-102214262 CTATATAAAAAAATGAATAAGGG + Intergenic
912790625 1:112646135-112646157 GTATATCCAGAAAGGGAGAATGG + Intronic
912896273 1:113593797-113593819 CTATATCATAAAATGAAGCAGGG + Intronic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
915985016 1:160455878-160455900 CAATATGTACAAAGGAAGAAAGG - Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916310800 1:163396804-163396826 ATATATACAAAAATGATGAATGG - Intergenic
916350030 1:163838521-163838543 ATCTACCCACAAATGAAGAAGGG - Intergenic
916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG + Intronic
917491218 1:175500336-175500358 CTACATCCACACAAGAAAAATGG - Intronic
919321907 1:196053219-196053241 CTATAACAAAAAAAGAAGAAAGG - Intergenic
920824458 1:209412470-209412492 CTAAATTAAGAAATGAAGAAAGG - Intergenic
921177114 1:212605188-212605210 TTATTTCCTCAAATGAAAAATGG - Intronic
921663767 1:217841153-217841175 CAATATGCAGAAATGAAGTAAGG + Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922260578 1:223940501-223940523 CTATATAAAAAACTGAAGAAAGG - Intergenic
922736494 1:227985229-227985251 CTATATAAAAAACTGAAGAAAGG + Intergenic
923315469 1:232775871-232775893 CTATATCCACATCTGTAAAATGG + Intergenic
923766712 1:236898843-236898865 ATATATTCAGTAATGAAGAATGG + Exonic
923791642 1:237116300-237116322 GTAAATCCTTAAATGAAGAAAGG - Intronic
923907558 1:238402267-238402289 ATATTTTTACAAATGAAGAAAGG + Intergenic
1064941062 10:20736016-20736038 CTATATTCACATATATAGAAAGG + Intergenic
1065641396 10:27786211-27786233 CTATATCCTGAATTGAGGAAAGG - Intergenic
1066734726 10:38462852-38462874 CTATATAAAAAACTGAAGAAAGG + Intergenic
1068057749 10:52032651-52032673 CTATTTCCAGCAATGAAAAAGGG - Intronic
1069288500 10:66746606-66746628 CCATTTCCTCAAATGCAGAATGG - Intronic
1069357579 10:67605176-67605198 CTATATATACAAAGGAAAAAAGG + Intronic
1069904140 10:71722573-71722595 CCATATCCCCACAGGAAGAAAGG - Intronic
1071035834 10:81244108-81244130 CTATATTCTCACATGCAGAAAGG - Intergenic
1072316403 10:94207481-94207503 CTATATACACAAATAAATGAGGG + Intronic
1072541568 10:96402300-96402322 CTAGTACCACAAATGTAGAAAGG - Intronic
1072797348 10:98366062-98366084 CTTTATCCCCAAATGAAAAGGGG + Intergenic
1075148385 10:119903281-119903303 CCATAACTACAAATGAACAAGGG - Intronic
1076968481 11:116231-116253 CTATATAAAAAACTGAAGAAAGG - Intergenic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078202968 11:9200804-9200826 GTATATCCCCAAAGGGAGAATGG - Intronic
1078466660 11:11555074-11555096 CAATTTCCACAACTGTAGAATGG - Intronic
1079290053 11:19179869-19179891 CTATATACATATTTGAAGAAAGG - Intergenic
1079900111 11:26172619-26172641 CAACATACACAAATCAAGAAAGG + Intergenic
1080774143 11:35370207-35370229 CTGTTTCCTCAACTGAAGAATGG - Intronic
1081037437 11:38166298-38166320 CAATATACACAAATCAATAAAGG - Intergenic
1081185126 11:40032914-40032936 CTATACCCAGGAATGAACAAGGG + Intergenic
1083565269 11:63709857-63709879 CTATATACATCAGTGAAGAATGG - Intronic
1086024116 11:82269364-82269386 CAAGATGCACAAATGAACAAAGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1089192557 11:116663654-116663676 CTGCATCCACAAAATAAGAATGG + Intergenic
1089235530 11:117021282-117021304 CTATTTGCACAAAAGAAAAATGG + Intronic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090367358 11:126218164-126218186 CCATATCCACATAACAAGAATGG - Intronic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1093135262 12:15441955-15441977 CTATTTCAAAAAATCAAGAAGGG + Intronic
1094408042 12:30139661-30139683 CTATTTACACAAAGAAAGAAAGG + Intergenic
1095739546 12:45592202-45592224 CTATGGCCAGAAAAGAAGAAGGG + Intergenic
1095979466 12:47963115-47963137 CTATACCCAGGAATGAACAAGGG + Intergenic
1096293469 12:50362438-50362460 CTATAGACAAAAATAAAGAAAGG + Intronic
1097517952 12:60629425-60629447 CTACATCAAAAAATGAAGTATGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1099178334 12:79449138-79449160 CTATATGGGCAAATGCAGAAAGG - Exonic
1099648698 12:85395877-85395899 ATATATCCAAATAGGAAGAAAGG + Intergenic
1101010490 12:100444386-100444408 CTATATTACCAAATGAAAAAGGG - Intergenic
1101025299 12:100597888-100597910 CTATATTTAAAAATCAAGAAAGG + Intronic
1101050184 12:100854730-100854752 GTATCCCCACAACTGAAGAAAGG - Intronic
1101698860 12:107152815-107152837 CTCTCTCCAGAAAGGAAGAAAGG + Intergenic
1101705776 12:107219715-107219737 CCAAATGCACAACTGAAGAATGG - Intergenic
1104149428 12:126068254-126068276 CTACAGCCACAAATGAACAGAGG - Intergenic
1104210208 12:126681722-126681744 TTAAATTCACAAATGAAGAGGGG - Intergenic
1104569575 12:129913068-129913090 CTATCTCCACAAACAAAAAAAGG + Intergenic
1104605197 12:130183029-130183051 CTAAATCCATAACTGGAGAAAGG + Intergenic
1107005844 13:35610488-35610510 CTATATCCAAAAAAAAGGAAGGG + Intronic
1109411882 13:61981225-61981247 CTATGCCCAGAAATGAACAAGGG - Intergenic
1110570815 13:77001054-77001076 CTTTATGCACCAAGGAAGAAAGG - Exonic
1110945737 13:81413516-81413538 ATTTATTCACAAATGAATAAAGG + Intergenic
1111956869 13:94768804-94768826 ATATATACACAAAGAAAGAAAGG + Intergenic
1113181005 13:107626413-107626435 GTATATACCCAAAAGAAGAAAGG + Intronic
1113268637 13:108647716-108647738 CTATATCTAAAAAAGAGGAATGG - Intronic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115009876 14:28532878-28532900 CAATAGCAACCAATGAAGAAAGG - Intergenic
1115311240 14:31980490-31980512 CTATACCAAAAAATGGAGAAGGG - Intergenic
1116370823 14:44128992-44129014 CAAAATCCATAAAGGAAGAAAGG + Intergenic
1117902796 14:60552413-60552435 CTAAATACACAAATTAAGATAGG - Intergenic
1120263423 14:82218097-82218119 GTTTATCCAGAAAAGAAGAATGG + Intergenic
1120573177 14:86147320-86147342 ATATTTCCACAAATAAATAATGG - Intergenic
1120624236 14:86804574-86804596 CTATATCCAGTAATGAAGAGAGG + Intergenic
1124075289 15:26438219-26438241 CTGTGTCCACACATGATGAAAGG + Intergenic
1124204322 15:27704196-27704218 CTACCTCTACACATGAAGAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1127282771 15:57505897-57505919 ATATATCCATAAATGCTGAAAGG - Intronic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1128859724 15:71057590-71057612 ATATATCCACAAATGAATGTGGG - Intergenic
1130485865 15:84398231-84398253 CCATATACAAAAATGAAGCAGGG - Intergenic
1130787698 15:87118499-87118521 CTCTATCCAAATATGAAAAATGG + Intergenic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1133525035 16:6596746-6596768 GTATATCCAAGAAGGAAGAAGGG - Intronic
1133537004 16:6711946-6711968 CTACAGCTACAAAGGAAGAATGG - Intronic
1139807756 16:69583793-69583815 CTACATCCAGAAAAGAAGGAAGG + Intronic
1140639187 16:76951920-76951942 ATATTTCCACAAATAAAAAATGG + Intergenic
1141020970 16:80496168-80496190 TTATATCCATAAAATAAGAATGG + Intergenic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142452195 16:90182889-90182911 CTATATAAAAAACTGAAGAAAGG + Intergenic
1144238692 17:13288083-13288105 CTATGCCCACAAATGACCAAGGG + Intergenic
1145027876 17:19482547-19482569 CTATATGAAAAAAAGAAGAAAGG - Intergenic
1146040151 17:29445201-29445223 CAATAAGCACATATGAAGAATGG + Intronic
1149241230 17:54652147-54652169 CTCTCTCCACATATGCAGAAAGG - Intergenic
1150940744 17:69691112-69691134 CTATATCCAAATATCAGGAATGG - Intergenic
1151927010 17:77205277-77205299 TTCTCTCCATAAATGAAGAAGGG + Exonic
1153207577 18:2719595-2719617 CTATCTCCAAAAAAGAAAAAAGG - Intronic
1156234682 18:35190782-35190804 CTATGTCCTCACATGATGAACGG - Intergenic
1156794594 18:41028130-41028152 CTACATACACGAATTAAGAAGGG - Intergenic
1156960111 18:43017735-43017757 CTATTTCTCCAAATGAAAAATGG - Intronic
1156972815 18:43177267-43177289 TTATATCCAGGAATGAACAAGGG + Intergenic
1159228806 18:65577420-65577442 CAATATCCACTAACGAAAAAGGG + Intergenic
1159282756 18:66309008-66309030 CTTTATCCAAAAATACAGAATGG - Intergenic
1160645290 19:186156-186178 CTATATAAAAAACTGAAGAAAGG - Intergenic
1165126448 19:33601200-33601222 CTATGCCCACAAATGAACAAGGG - Intergenic
925691697 2:6530927-6530949 CTATAGACAAAATTGAAGAATGG + Intergenic
927002243 2:18809815-18809837 GTTTATCCACAAATGAACACGGG + Intergenic
927410432 2:22818940-22818962 GTATTTTCACAAATAAAGAAAGG + Intergenic
928885022 2:36138485-36138507 TTATATCCACAAGAGATGAATGG - Intergenic
929112183 2:38414242-38414264 AGATATACACAAAAGAAGAAAGG + Intergenic
931957504 2:67443809-67443831 CTATCTGCAGAAGTGAAGAATGG - Intergenic
933301378 2:80545001-80545023 CCATCTCCAACAATGAAGAAGGG + Exonic
935469966 2:103447098-103447120 CTGTATCCTAAAATGAAGAGTGG - Intergenic
935514191 2:104015435-104015457 CAAAATCCACAAATGACAAAAGG - Intergenic
937517294 2:122669925-122669947 CAATATTCAAAAATGCAGAATGG - Intergenic
938041187 2:128077460-128077482 CTATGCCCACGAATGAACAAGGG + Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939178103 2:138773508-138773530 CTACACACACAAATGAGGAATGG + Intronic
939755411 2:146103328-146103350 CTATGTCCAGAAATGAACAAGGG + Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
941028931 2:160490821-160490843 CTATATCAAAAACTGAAGAATGG - Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942331751 2:174832687-174832709 CTGTATCAATAAATGTAGAAGGG - Intronic
943074355 2:183176598-183176620 CTATCTCAATAAATGCAGAAAGG - Intergenic
945062407 2:205920676-205920698 CTATTTCCTCAACTGAAAAATGG + Intergenic
945555481 2:211270429-211270451 CTACATCCAGGAATGAACAAGGG - Intergenic
949083637 2:242127532-242127554 CTATATAAAAAACTGAAGAAAGG + Intergenic
1169541874 20:6608241-6608263 CCACATCTACAAATTAAGAATGG - Intergenic
1170216648 20:13898654-13898676 CTCTACCCATAAATGAAGAATGG - Intronic
1170444480 20:16411766-16411788 CAATATCCACAAAGGAAAAGAGG - Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1172797667 20:37553339-37553361 CCATATCCAAAAAAGTAGAAAGG + Intergenic
1173210291 20:41027265-41027287 CAATATCCACAAAGGAGTAATGG + Intergenic
1175143073 20:56874824-56874846 CAATATCCACATCTGTAGAATGG - Intergenic
1176280221 20:64300065-64300087 CTATATGAAAAACTGAAGAAAGG + Intergenic
1178187634 21:30241755-30241777 CTACTTTCATAAATGAAGAAAGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1182760500 22:32718734-32718756 CTTTAGACACAAATGAAGACAGG + Intronic
949335762 3:2973547-2973569 CTCTACCCACACATCAAGAAAGG + Intronic
949588065 3:5463032-5463054 CTTTATCATCAAATGTAGAATGG - Intergenic
949603271 3:5624955-5624977 CTATATCCTCAAATGGCAAAAGG - Intergenic
950295391 3:11825179-11825201 CAGTATCCTCAAATGAAAAAGGG + Intronic
952090569 3:29880520-29880542 CTCTTTCCACAAAGGAAAAAAGG - Intronic
952212562 3:31243067-31243089 CTACATAAACGAATGAAGAATGG - Intergenic
956484343 3:69705966-69705988 TTTTTTCCACAAATGAAAAAAGG - Intergenic
957618119 3:82558854-82558876 CTATATCCACATATTAATATTGG + Intergenic
958758316 3:98276081-98276103 CTACATGCAGGAATGAAGAAGGG - Intergenic
958963399 3:100532917-100532939 CTATGTCCAAAAAGGAACAAAGG - Intronic
959266945 3:104153945-104153967 CTATATCAACAAAAGCAAAAAGG - Intergenic
959637732 3:108594006-108594028 CTATATCTACAATTAAGGAAAGG - Intronic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
963420749 3:145058002-145058024 CTAAATCAACAAGTAAAGAAAGG + Intergenic
963578563 3:147095496-147095518 CAATATACACAAATCAATAAAGG - Intergenic
964336795 3:155662983-155663005 TTATAGCCAAAAAAGAAGAAAGG - Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
964935912 3:162086912-162086934 CAATAGCCACAAATAAAGATAGG - Intergenic
965195449 3:165588854-165588876 CAATATACACAAATCAATAAAGG + Intergenic
966016317 3:175142194-175142216 TTAGATGCACAAATGAAAAATGG - Intronic
966031902 3:175359840-175359862 CTAGGACCAGAAATGAAGAAAGG + Intronic
966558085 3:181286166-181286188 CTGTGTCCTCACATGAAGAAGGG - Intergenic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967749495 3:193097703-193097725 CTATATCCAAGGATGAAGCAGGG - Intergenic
968372393 3:198233370-198233392 CTATATAAAAAACTGAAGAAAGG + Intergenic
971643365 4:29163998-29164020 CTATATCTTCAAATTAACAATGG - Intergenic
972457173 4:39265891-39265913 CTCTAGCAACAAATGAAGAAAGG + Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
977067663 4:92339200-92339222 GTATATCAATAAATGAATAATGG - Intronic
979012166 4:115386292-115386314 CAATATACACAAATCAATAAAGG - Intergenic
979174520 4:117646641-117646663 CAATAACAACCAATGAAGAAAGG - Intergenic
979261080 4:118645829-118645851 CTATATAAAAAACTGAAGAAAGG + Intergenic
979358097 4:119729396-119729418 CTATTTCCAGGAATGAACAAGGG + Intergenic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
979983169 4:127281748-127281770 CTACATCCAGAAGTGAAAAATGG + Intergenic
980001932 4:127499570-127499592 TTAAAATCACAAATGAAGAACGG + Intergenic
980786085 4:137557184-137557206 CTCTTTCTACAAATGCAGAATGG - Intergenic
983150763 4:164277487-164277509 CTATATAAAAAACTGAAGAAAGG - Intronic
983329922 4:166312472-166312494 CTCTATTCAGAAAAGAAGAAAGG - Intergenic
984122063 4:175757788-175757810 CTGTATCCAAGAAGGAAGAAGGG + Intronic
984515936 4:180739078-180739100 CTCTATCCACCAATGTACAAGGG + Intergenic
984572951 4:181415252-181415274 TTATACCTACAAATGTAGAAAGG + Intergenic
986211384 5:5676281-5676303 CAAGATCCACAAATGAACCAGGG - Intergenic
987639641 5:20596058-20596080 AAATATCCCCAAATGAAGAGTGG - Intergenic
987701138 5:21399896-21399918 ATTTATCAACAAATGAAGAAAGG + Intergenic
992501873 5:77351240-77351262 TTACATCCACAAATGCAGTAGGG + Intronic
993505045 5:88698782-88698804 TAATATATACAAATGAAGAATGG - Intergenic
995349735 5:111161288-111161310 CTATGTCCTCAAATGGCGAAAGG - Intergenic
996783849 5:127217043-127217065 CTATATCCATGAATGAAGCAGGG - Intergenic
997011045 5:129877913-129877935 TTAGATTCACAAATGAACAATGG - Intergenic
998624729 5:143833412-143833434 CCATATCTACAAATGAAGGGGGG - Intergenic
998688768 5:144562241-144562263 CTATATCAACAAAAGGAGCATGG - Intergenic
999892268 5:155991959-155991981 ATATAGACAGAAATGAAGAAAGG - Intronic
1001423781 5:171609568-171609590 CTATGTCTACAAATAGAGAAAGG + Intergenic
1002369525 5:178740384-178740406 CTATATCCATGAATGAAGCAGGG + Intergenic
1002731633 5:181338914-181338936 CTATATAAAAAACTGAAGAAAGG + Intergenic
1002752899 6:135180-135202 CTATATGAAAAACTGAAGAAAGG - Intergenic
1002809743 6:616194-616216 CAATAAGCACAAATAAAGAATGG + Intronic
1003777143 6:9380178-9380200 CAAGAGCCACAAGTGAAGAATGG + Intergenic
1004002548 6:11608471-11608493 CTATTTCTTCCAATGAAGAATGG + Intergenic
1004287688 6:14337831-14337853 CTATCTCCACAGAGAAAGAATGG - Intergenic
1006070091 6:31491925-31491947 CTATGCCCAGAAATGAACAAGGG + Intergenic
1007234553 6:40381085-40381107 CAATATCCTCAAATGTAAAATGG - Intergenic
1007754633 6:44091080-44091102 CTATGTCCACCACTGATGAATGG + Intergenic
1007895332 6:45350460-45350482 CTATTTCAACAAAGGAAGCAGGG + Intronic
1008259945 6:49353180-49353202 CTATTTCCAAAAATCAAGAAGGG + Intergenic
1009304700 6:62073874-62073896 GTCTATCCTCAAAAGAAGAACGG + Intronic
1009525874 6:64745699-64745721 CTATGTCCAAAAATCCAGAAGGG + Intronic
1009632565 6:66217147-66217169 CTATATCCATTAAGGAAAAATGG - Intergenic
1011606628 6:89112741-89112763 CTATATTAAAAAATGAAAAAAGG - Intronic
1011676650 6:89741396-89741418 CTATACCCAGGAATGAACAAGGG - Intronic
1011898543 6:92262503-92262525 ATATATCTAAAAGTGAAGAATGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012454214 6:99386591-99386613 CAATATCAAGAAATAAAGAAAGG + Intronic
1012601860 6:101108576-101108598 CTATGAACACCAATGAAGAAGGG - Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013389670 6:109671000-109671022 CCATATCCACATATGTAGACAGG - Intronic
1013544996 6:111147767-111147789 CTATGTCCACAAAACAAAAAGGG - Intronic
1016128065 6:140430862-140430884 CTAATACCACAAATGAAAAAAGG - Intergenic
1016462927 6:144296911-144296933 CTAGAGCCAAAAATCAAGAAAGG - Intronic
1017274560 6:152551092-152551114 TTATATCCACAAATAGAGGAAGG - Intronic
1018007332 6:159634698-159634720 CTAAATCCACAGAAGAATAAGGG + Intergenic
1020853842 7:13391883-13391905 CTATAGACACACGTGAAGAAAGG + Intergenic
1021001405 7:15335792-15335814 CTGAAACCACAACTGAAGAAAGG - Intronic
1021182297 7:17520807-17520829 CTATGTCAACTAATGAAAAAAGG - Intergenic
1022205366 7:28158571-28158593 CTATTTCCACAACCGAATAAAGG + Intronic
1022865657 7:34416670-34416692 CTATATCGTAAAATGAAGGAAGG - Intergenic
1023950843 7:44843473-44843495 GTATATTTACAAATGAGGAAGGG - Intronic
1025221081 7:57108379-57108401 CTATACACACAAAAGAAAAAAGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027287966 7:76669778-76669800 CTATCTCAATAACTGAAGAAAGG + Intergenic
1027500916 7:78950102-78950124 GTCTAACCCCAAATGAAGAAGGG - Intronic
1028260273 7:88655834-88655856 CTATATTTACAAATGAAAAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1029498062 7:100908655-100908677 CTATATCAACAAATGAAGGCTGG - Intergenic
1030567868 7:111183100-111183122 CTAAACCAAAAAATGAAGAAAGG + Intronic
1031656979 7:124368318-124368340 TTGTATCCTCAAATGAAGCAAGG + Intergenic
1031749490 7:125554502-125554524 TTATATCCTCACATGGAGAAGGG - Intergenic
1034829526 7:154297363-154297385 CTTTATTCACAAAATAAGAAGGG + Intronic
1034840891 7:154395147-154395169 CTGTGTCCTCAAATGATGAAAGG + Intronic
1035511883 8:195365-195387 CTATATAAAAAACTGAAGAAAGG - Intronic
1037016957 8:13920064-13920086 TTATATCAAAATATGAAGAAAGG - Intergenic
1038092120 8:24266623-24266645 CGATGTCCACAAGTGCAGAAAGG + Intergenic
1039628610 8:39082899-39082921 CTATATCATCAACTCAAGAATGG - Intronic
1040877848 8:52171568-52171590 CTATTTTCACACATGAAAAAAGG - Intronic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1043220812 8:77661530-77661552 CTACGACCAGAAATGAAGAAGGG - Intergenic
1043333731 8:79148604-79148626 CTATAACAGCAAATGTAGAAAGG - Intergenic
1044032726 8:87258363-87258385 CTACACACACAAATAAAGAAGGG - Intronic
1044278426 8:90328859-90328881 CTGTTTCCACAAATCAATAAAGG + Intergenic
1044702312 8:94975821-94975843 TTATATCCACAAAATGAGAATGG - Intronic
1046319086 8:112547046-112547068 CTATTTGCTCAAAAGAAGAATGG + Intronic
1047240802 8:123086252-123086274 CTATTATCACAATTGAAGAAAGG - Intronic
1050725321 9:8642877-8642899 CTATACCAACACATGACGAAAGG + Intronic
1051701261 9:19826628-19826650 CTGTGTCCTCACATGAAGAAAGG + Intergenic
1052418032 9:28202713-28202735 CTATTTTCACAAATGTAAAATGG + Intronic
1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG + Intergenic
1052840925 9:33290282-33290304 CTATATCAAAAAATAAAAAAAGG + Intergenic
1053118155 9:35523941-35523963 CTAAATCAATAAATTAAGAAAGG + Intronic
1056483766 9:87033604-87033626 GTAAATCCAGAAAAGAAGAAGGG + Intergenic
1057288692 9:93784214-93784236 CAATAGCCACAAATGAAATAAGG - Intergenic
1058543247 9:106034068-106034090 CTTTATCCACAAATTACCAAGGG - Intergenic
1058569072 9:106321222-106321244 GTATATGCTCAAATGATGAAAGG - Intergenic
1058793332 9:108472682-108472704 CTATATCAACAAAGGTATAAAGG + Intergenic
1059285864 9:113170995-113171017 CTCTAACCACAGAAGAAGAATGG - Intronic
1059398020 9:114050929-114050951 CTATCTCCCCAAATCAGGAAAGG + Exonic
1060205316 9:121679393-121679415 GTACATGCACAAATGCAGAAGGG - Intronic
1062756039 9:138291424-138291446 CTATATAAAAAACTGAAGAAAGG + Intergenic
1188688133 X:33095841-33095863 TGATATCCAAAAATGAAGACAGG + Intronic
1191590777 X:62881949-62881971 CAATATACACAAATCAATAAAGG + Intergenic
1192353528 X:70378195-70378217 CTATATTAAAAAATGCAGAAAGG + Intronic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192704744 X:73517976-73517998 CTATATCCTCATATGACAAAAGG + Intergenic
1192910467 X:75598803-75598825 CAATATACACAAATCAATAAAGG - Intergenic
1195293664 X:103454285-103454307 CTATATCCCCATCTGTAGAAAGG + Intergenic
1195597486 X:106709254-106709276 CAATATCCACAAATGAGCAATGG - Intronic
1196991944 X:121339486-121339508 CTATATACTCAAATAAAGGAAGG + Intergenic
1198137480 X:133768483-133768505 CTTTATCCAAAAATTAAGGAGGG - Intronic
1198144149 X:133838189-133838211 CAATATTCATAAATGAAAAATGG - Intronic
1198846032 X:140911770-140911792 CTATATGCACAAAGGAAAAGAGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1200176472 X:154120563-154120585 CTATAACCACAGATGCAGACAGG - Intergenic
1201400797 Y:13602004-13602026 ATATACTCACAAAAGAAGAAGGG - Intergenic
1201624471 Y:15999039-15999061 CTATAACAACAAATGAATAAAGG - Intergenic
1202071429 Y:20995729-20995751 CCATATCAACCAATGGAGAAAGG + Intergenic
1202277582 Y:23140363-23140385 CTATATCCTGAAATATAGAAGGG + Intronic
1202277738 Y:23142744-23142766 CTACATCCAGAAATGAAGAATGG + Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202287465 Y:23266023-23266045 CTACATCCAGAAATGAAGAATGG - Intronic
1202287630 Y:23268407-23268429 CTACATCCAGAAATGAAGAATGG - Intronic
1202287795 Y:23270792-23270814 CTACATCCAGAAATGAAGAATGG - Intronic
1202287959 Y:23273176-23273198 CTACATCCAGAAATGAAGAATGG - Intronic
1202288125 Y:23275560-23275582 CTACATCCAGAAATGAAGAATGG - Intronic
1202288289 Y:23277944-23277966 CTACATCCAGAAATGAAGAATGG - Intronic
1202288446 Y:23280325-23280347 CTATATCCTGAAATATAGAAGGG - Intronic
1202368365 Y:24181851-24181873 CCATATACAAAAATGAAGCAGGG - Intergenic
1202382544 Y:24288241-24288263 CTATATAAAAAACTGAAGAAAGG + Intergenic
1202430573 Y:24774087-24774109 CTATATCCTGAAATATAGAAGGG + Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic
1202439405 Y:24884080-24884102 CTACATCCAGAAATGAAGAATGG - Intronic
1202439569 Y:24886465-24886487 CTACATCCAGAAATGAAGAATGG - Intronic
1202439734 Y:24888850-24888872 CTACATCCAGAAATGAAGAATGG - Intronic
1202439899 Y:24891234-24891256 CTACATCCAGAAATGAAGAATGG - Intronic
1202440064 Y:24893619-24893641 CTACATCCAGAAATGAAGAATGG - Intronic
1202440219 Y:24896000-24896022 CTATATCCTGAAATATAGAAGGG - Intronic
1202488240 Y:25381884-25381906 CTATATAAAAAACTGAAGAAAGG - Intergenic
1202502420 Y:25488266-25488288 CCATATACAAAAATGAAGCAGGG + Intergenic