ID: 1202432914

View in Genome Browser
Species Human (GRCh38)
Location Y:24806377-24806399
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 7, 1: 0, 2: 0, 3: 15, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202432914_1202432919 -2 Left 1202432914 Y:24806377-24806399 CCCACATCCCATTGTTCATGATG 0: 7
1: 0
2: 0
3: 15
4: 152
Right 1202432919 Y:24806398-24806420 TGTATGTTAAGGTAAAAATGAGG 0: 7
1: 0
2: 6
3: 25
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202432914 Original CRISPR CATCATGAACAATGGGATGT GGG (reversed) Intronic
900749162 1:4383365-4383387 CATCAGGGACAGTGGGAGGTGGG + Intergenic
906194177 1:43919735-43919757 CAGAATGGACACTGGGATGTCGG + Intronic
907260374 1:53213630-53213652 CATCATGAAAACTGGGAGGCCGG + Exonic
908993152 1:70118779-70118801 TTTCATGAACAATGGGGGGTGGG + Intronic
910593089 1:88949127-88949149 CATCAGGAACTATGGGTTTTAGG + Exonic
912658949 1:111511903-111511925 CATCATGAACACTGTGATTTGGG - Intronic
913436039 1:118848786-118848808 CATCATGAACCAAGGGAAATTGG + Intergenic
915246159 1:154557955-154557977 AATCATGAACCTTGGGATGTGGG + Intronic
916468734 1:165100388-165100410 CATTATGAACAATAGTATGAAGG + Intergenic
916650181 1:166828020-166828042 CAGCAAGAACAAAGGGATTTTGG + Intergenic
920127889 1:203708209-203708231 CAGCGTGAGAAATGGGATGTGGG - Intronic
920326298 1:205167434-205167456 CTTCATGAAAAATGGCATTTGGG + Intronic
1069220919 10:65882231-65882253 CATTATGAAAAATGGTATGGAGG - Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070430653 10:76334441-76334463 AATCATGAAAAATGGCCTGTCGG + Intronic
1071493998 10:86155290-86155312 CATCTTGAAGAATGGCAGGTTGG - Intronic
1071805911 10:89120772-89120794 AACCGTGAACAATGGGATGGAGG + Intergenic
1076112194 10:127869170-127869192 CAACATTAACATTGTGATGTAGG + Intergenic
1077678406 11:4217741-4217763 CTTCATGATCAATTGGATGAAGG - Intergenic
1077726650 11:4681892-4681914 CAACACGCACAATGGGATGAAGG + Exonic
1078589110 11:12622498-12622520 CATCAGGAACTATGGAATCTGGG + Intergenic
1081134736 11:39426237-39426259 CATGATGAAAAATGGTATGAAGG + Intergenic
1083406860 11:62463593-62463615 CAGCACGCACAGTGGGATGTAGG - Intronic
1084675661 11:70632594-70632616 CATCAGGGAAAATGGTATGTGGG - Intronic
1085329868 11:75639336-75639358 CAACAGGAAGAAAGGGATGTGGG - Intronic
1085976804 11:81665549-81665571 CATTATGAACAATGGAACATGGG - Intergenic
1086231284 11:84572910-84572932 CAGCATGAACATTAGTATGTTGG - Intronic
1088010412 11:104994396-104994418 CATAATGAAGGATGGGATGAAGG - Intronic
1093783497 12:23165404-23165426 CTTCATGAACAAAGGTATTTAGG + Intergenic
1093880293 12:24396491-24396513 CAGCATGAACAATGGGAACCGGG - Intergenic
1103756782 12:123214019-123214041 CATCCTGATGAATTGGATGTGGG + Intronic
1105531828 13:21227775-21227797 CAAAATAAACAATGGGGTGTTGG - Intergenic
1106925452 13:34608313-34608335 CATCATGAACAACTTGATGGGGG - Intergenic
1113824138 13:113237227-113237249 CTTCATGCACACTCGGATGTAGG + Intronic
1114921461 14:27336495-27336517 CATCATGAATAGTAGTATGTAGG + Intergenic
1114991492 14:28295402-28295424 GATGATGAGCAAGGGGATGTGGG + Intergenic
1115018822 14:28649780-28649802 CATCATGAAGAATGTGATCTAGG + Intergenic
1116852255 14:49920228-49920250 CATCATGAACAATGTGTTCTTGG + Intergenic
1118132393 14:62981688-62981710 CATCACCAACAGTGGGATGCCGG - Intronic
1118141019 14:63082722-63082744 CATTATGAACAATAGTATGGAGG + Intronic
1119824192 14:77643339-77643361 CATCAGTAAGAATGGGATGAAGG - Intergenic
1120268683 14:82282698-82282720 CATCATGAACATGGGAAAGTGGG - Intergenic
1120939658 14:89935143-89935165 CATGATGAACAAAGGGCCGTCGG - Intronic
1130195793 15:81779218-81779240 GGTCAGGAACAAAGGGATGTGGG - Intergenic
1131569813 15:93523477-93523499 CAGCATGCCCAATGGGATGGGGG - Intergenic
1132874669 16:2131027-2131049 CCTCTGGGACAATGGGATGTCGG + Intronic
1133414259 16:5594000-5594022 CCTCATGAACAATGGGCAGAAGG - Intergenic
1134553610 16:15149860-15149882 CCTCTGGGACAATGGGATGTCGG + Intergenic
1137341425 16:47610416-47610438 CACCAAAATCAATGGGATGTGGG - Intronic
1137945202 16:52727228-52727250 CATCATTAACAATGGATTGTTGG - Intergenic
1141849579 16:86636191-86636213 CATCATGATCTAGGGGTTGTGGG + Intergenic
1142662193 17:1438730-1438752 CATTCTGAACTATGGTATGTAGG - Intronic
1148735136 17:49860929-49860951 CCTCATGAGCATTGGGCTGTTGG - Intergenic
1151925519 17:77193095-77193117 CATCATGAACAAAGAGGTATTGG - Intronic
1156291941 18:35755094-35755116 GACCAGGAACACTGGGATGTAGG + Intergenic
1156393805 18:36678925-36678947 AATCATGTAAAATGGGTTGTGGG + Intronic
1157551438 18:48584486-48584508 CATCACACACAATGGGATTTTGG - Intronic
1158256932 18:55561950-55561972 CATCATCAGCAATGTGATCTTGG - Intronic
1159572120 18:70127638-70127660 CAGCCTGAACAATGGAATGGAGG + Exonic
1159848031 18:73489683-73489705 CATTACGAAGAATGGGAAGTGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166253849 19:41588599-41588621 CATCATTAACAATGAGAAGGTGG - Intronic
1166362047 19:42256603-42256625 CATCATGAACACTCGGAATTCGG - Intergenic
1166908507 19:46133195-46133217 CATTCCCAACAATGGGATGTGGG - Intergenic
1167786800 19:51644007-51644029 GATCCTGAGCAATGGCATGTCGG - Exonic
926992109 2:18691026-18691048 CTTCATGAAGGATGGGAAGTGGG - Intergenic
927243863 2:20941413-20941435 CATCATGAGCAAGGTGAGGTGGG - Intergenic
929384884 2:41394732-41394754 CATCAGGCTCAATGGAATGTGGG + Intergenic
929392570 2:41487941-41487963 CAGCAGGACAAATGGGATGTGGG + Intergenic
930325590 2:49913405-49913427 CAACATGCACAGTGTGATGTTGG + Intergenic
932066599 2:68569714-68569736 CATCATGAACATGGAGAGGTTGG + Intronic
935631952 2:105219310-105219332 CATCATGCACAAAGGGCTGGAGG + Intergenic
935695674 2:105768918-105768940 ACTCTTGAAAAATGGGATGTGGG - Intronic
935928793 2:108100364-108100386 CATGATGAACATTGCCATGTAGG - Intergenic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
937341712 2:121095579-121095601 CAGCAGGGACAGTGGGATGTGGG + Intergenic
938984051 2:136555779-136555801 CATAATGAAAAATGGTATGGAGG + Intergenic
939682708 2:145158413-145158435 AATCATGACCAATGGGCTTTAGG + Intergenic
940312511 2:152293427-152293449 ATTCATGAACAATGGAATGTTGG - Intergenic
940866838 2:158825798-158825820 CCTCATGAAGACTGGGATGGTGG - Intronic
941533768 2:166697818-166697840 CATTAGGAACAATGTCATGTGGG - Intergenic
944582126 2:201140173-201140195 CATCATGAAGAATGGAGTATAGG - Intronic
945180196 2:207083870-207083892 CATCATGAGCCAAGGAATGTGGG + Intronic
948387276 2:237588860-237588882 CACCATGACCACTGGGATGCCGG + Intronic
1172665137 20:36593780-36593802 CATTATGTAAAATGGGGTGTTGG + Exonic
1173102949 20:40104611-40104633 CAACATGAACAGTGGCATCTAGG - Intergenic
1175708208 20:61196992-61197014 CATCATGAATAATGGAAAATGGG + Intergenic
1177768848 21:25492073-25492095 CATCATGAAAAATGATACGTAGG - Intergenic
1184079252 22:42206936-42206958 CACCATGAGCAATGGGAAGCTGG + Intronic
949264844 3:2144659-2144681 CATTATTAACATTAGGATGTGGG - Intronic
950911434 3:16598394-16598416 CATTATGAATAATGGGATTTGGG - Intronic
951326615 3:21309880-21309902 TATGATGTACAATGTGATGTTGG - Intergenic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
952542933 3:34386975-34386997 CATCATGAGCAATGGGAAAAAGG - Intergenic
954212524 3:49106113-49106135 GGTCATTAATAATGGGATGTGGG - Intergenic
954749199 3:52804180-52804202 CAGCATGGACAGTGGGGTGTGGG + Intronic
955349524 3:58183521-58183543 CAACAGGAGAAATGGGATGTGGG + Intergenic
956197197 3:66664799-66664821 CATCAAGATCAAGGGGATGTCGG - Intergenic
957050049 3:75404571-75404593 CACCATGACCAACTGGATGTAGG + Intergenic
958450488 3:94266862-94266884 AATCATAAAGAATGGGATTTGGG + Intergenic
961382954 3:126507963-126507985 CGTCATCACCAATGGGATGGTGG - Exonic
962485939 3:135842356-135842378 CCTCATGAGCAATTGGAAGTGGG - Intergenic
966636912 3:182145250-182145272 TAGCATGAACAATGGCATGAAGG - Intergenic
967327081 3:188251770-188251792 CATAATGACCATTGGGATATAGG - Intronic
968801791 4:2747674-2747696 CAGCATGCACAAAGGAATGTGGG - Exonic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
973293668 4:48492345-48492367 CAGCATGAAGAATGTGATCTTGG + Intronic
974476042 4:62381770-62381792 CATTATGAAAAATGGTATGGAGG + Intergenic
974525640 4:63046858-63046880 CATGATGAAAAATGGGATATTGG - Intergenic
977352229 4:95903324-95903346 CATCATGATGAAGTGGATGTTGG - Intergenic
980381339 4:132022481-132022503 CATCATAAAAATTAGGATGTGGG + Intergenic
980864357 4:138536926-138536948 CATTATGGACAATGGTATGTAGG + Intergenic
981011311 4:139928130-139928152 CAGCATGAACCCTGTGATGTTGG - Intronic
981498192 4:145416896-145416918 TTTCCTGAACAATGGAATGTGGG + Intergenic
981565499 4:146097209-146097231 CATCATGAGAAATATGATGTTGG + Intergenic
982278610 4:153661953-153661975 GATTATGAAGAATGGGAAGTTGG + Intergenic
982844743 4:160236016-160236038 CATCAAGAACAGTGGGAACTGGG + Intergenic
984960589 4:185093705-185093727 AAAGATCAACAATGGGATGTAGG + Intergenic
986220291 5:5762948-5762970 CATCATACACAAGGGGATTTTGG - Intergenic
993400361 5:87442092-87442114 AAACTTGAACAATGAGATGTTGG - Intergenic
994814442 5:104567399-104567421 CTTCATGAATAATTGGAAGTGGG - Intergenic
996087490 5:119320008-119320030 GATCATGAACCATGGGTTGGTGG + Intronic
996266374 5:121545969-121545991 CATTATGAAAAATGGTATGGAGG - Intergenic
998412431 5:141921858-141921880 AAGCATGAACAATGGATTGTGGG - Intergenic
1003478025 6:6502914-6502936 CATCATATAAAATGGCATGTAGG - Intergenic
1003622769 6:7716119-7716141 CACCAAGAACAATCAGATGTAGG + Intergenic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1007993808 6:46284844-46284866 CTTCATGAATTATGGGATATGGG + Intronic
1008404678 6:51105547-51105569 AGTCATAAACAATGGAATGTGGG - Intergenic
1012262948 6:97109450-97109472 CATCATGACACATGTGATGTGGG + Intronic
1014175156 6:118324234-118324256 CATTCTGAACCATGGGATGCTGG - Intergenic
1014347493 6:120292642-120292664 CATTATGAAAAATGGTATGGAGG - Intergenic
1016488709 6:144572320-144572342 CTTCTTGAAAAATGGTATGTAGG + Intronic
1023419842 7:39967657-39967679 CATCATGGATAATGGTATGGAGG - Intronic
1026060898 7:67024959-67024981 CAACATCAACAATGGAATTTAGG - Exonic
1026326585 7:69315726-69315748 GATAATGAAAGATGGGATGTGGG - Intergenic
1026717469 7:72802441-72802463 CAACATCAACAATGGAATTTAGG + Exonic
1029647172 7:101864977-101864999 CATCATGAATAATACCATGTGGG - Intronic
1034869618 7:154672493-154672515 CAGCATGAAGAATTGGATGGTGG + Intronic
1036133709 8:6139801-6139823 CAGCATTTACAATGGGATGTGGG + Intergenic
1037871621 8:22502824-22502846 AATCATTAACAGTGGGAGGTTGG + Intronic
1041861416 8:62517611-62517633 CCCCAAGAAGAATGGGATGTGGG + Intronic
1048150978 8:131893824-131893846 CAGCATGAAGAATGAGCTGTGGG - Intergenic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1051007011 9:12357461-12357483 GATTAGGAAGAATGGGATGTTGG - Intergenic
1056216118 9:84407849-84407871 CAGCATGAAGAATGGGATCTCGG - Intergenic
1057561639 9:96132644-96132666 CAACATGAACAAAGGCATGGAGG - Intergenic
1058028139 9:100165365-100165387 CCTAATGAACAATGGGCTCTAGG - Intronic
1058728296 9:107824656-107824678 AATCATGAGCAATGATATGTGGG + Intergenic
1059140365 9:111847375-111847397 CAGCATGGACAATGGAATGGAGG + Intergenic
1059220825 9:112616913-112616935 CATCATGAACACAGAGATGCTGG + Intronic
1059390040 9:113993415-113993437 CATCAAGAAGAATGGCAAGTAGG - Intronic
1059795351 9:117688793-117688815 CATCAGAAACAATGGGAGGCCGG + Intergenic
1060760652 9:126245452-126245474 CAGCATGGAGAATGGGTTGTAGG + Intergenic
1186351079 X:8740302-8740324 CATTATGAACATTGAGATGCTGG - Intergenic
1187124587 X:16442861-16442883 CATCATGGAAAATGGTATGGAGG + Intergenic
1187849919 X:23581736-23581758 CAGCATGATGAATGGGATCTTGG - Intergenic
1189680163 X:43507669-43507691 TATCATGAACTATAGGCTGTGGG - Intergenic
1189681273 X:43519155-43519177 CATCTTGAATAAGGGGATATTGG - Intergenic
1189737076 X:44082594-44082616 AGTCATGAACAAAGGGATGTTGG - Intergenic
1190521516 X:51283074-51283096 CATCATGGGCAATGACATGTAGG - Intergenic
1195029463 X:100912292-100912314 CATCATGAAAAATGGAATGGGGG + Intergenic
1195734095 X:107995661-107995683 CATCAGGAAAAATGGCAGGTAGG + Intergenic
1195964484 X:110417807-110417829 CATCAGCCTCAATGGGATGTTGG - Intronic
1196023028 X:111010241-111010263 CATCATGAATAATGGCTTCTTGG + Intronic
1196686489 X:118514704-118514726 CAGCATGCACAAAGGTATGTAGG - Intronic
1198946160 X:142016982-142017004 GATCATGAACAACGGGAGGGAGG - Intergenic
1202279784 Y:23170306-23170328 CATCATGAACAATGGGATGTGGG - Intronic
1202280513 Y:23181146-23181168 CATCATGAACAATGGGATGTGGG - Intronic
1202281242 Y:23191994-23192016 CATCATGAACAATGGGATGTGGG - Intronic
1202284649 Y:23226526-23226548 CATCATGAACAATGGGATGTGGG + Intronic
1202432914 Y:24806377-24806399 CATCATGAACAATGGGATGTGGG - Intronic
1202436323 Y:24840913-24840935 CATCATGAACAATGGGATGTGGG + Intronic
1202437051 Y:24851761-24851783 CATCATGAACAATGGGATGTGGG + Intronic