ID: 1202433848

View in Genome Browser
Species Human (GRCh38)
Location Y:24815014-24815036
Sequence TACTGTGAGCGTGTCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202433848_1202433849 15 Left 1202433848 Y:24815014-24815036 CCTTTAAGGACACGCTCACAGTA No data
Right 1202433849 Y:24815052-24815074 CTACTTATCTTGAATAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202433848 Original CRISPR TACTGTGAGCGTGTCCTTAA AGG (reversed) Intergenic
No off target data available for this crispr