ID: 1202441954

View in Genome Browser
Species Human (GRCh38)
Location Y:24917491-24917513
Sequence CAGTTTAGCCTCAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202441944_1202441954 19 Left 1202441944 Y:24917449-24917471 CCTTGGGGATGTTCAGTCACTAG No data
Right 1202441954 Y:24917491-24917513 CAGTTTAGCCTCAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202441954 Original CRISPR CAGTTTAGCCTCAGGGATGA AGG Intergenic
No off target data available for this crispr