ID: 1202444762

View in Genome Browser
Species Human (GRCh38)
Location Y:24947728-24947750
Sequence TTACACAGCTTGGAAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202444754_1202444762 23 Left 1202444754 Y:24947682-24947704 CCTGAGGAAACTGATGTTTGGAG No data
Right 1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202444762 Original CRISPR TTACACAGCTTGGAAATGAG AGG Intergenic
No off target data available for this crispr